--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (56679 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5697       5761   0    Initial     65    49    Marginal
gaatcctgcacagccttgcactacgatttgctttgaggagatactgtataaatattgtct
tcagttgcacaagtattgaacgataaaggcataagatctgcttttagccaataatgttac
agttaagcagttaatgttggcagcagccagcctcagtgagtttggtgaagtgccaaatga
ATGAAGTATCTTGCTGAGTATTCTACTAATCAGCCATCCGAGGACTTACCAGATGCTCAC
CAAAG
gtgacataatgattaacttatatagtcacatatatgtattctcattatatattcaaatcc
gtgcatacattcattcaacaagtatttgagtacttacatgatgttatgtactatgctagg
tgctgggtatactgtggtaaaggaaacggtggggggttggggtggggtggggtggggtga

Exon  2 +      11972      12115   0   Internal    144    49    Marginal
attaatcttgtatccagaaactttgctgaattcttttatcagctctaggagctttctgga
ggagtccttagaattttcaaggtaaacgatcatatcaccagcaaacagtgacagtttgac
ttctttcttagcaatttggatgccctttatttccttctcttgtctgattgctctggctag
GACTTCCACTACTATGTTGAAGAGGAGTGGTGTGAGTGGGCATCCTTGTCTTGTTCCCGT
TCTCAGAGAGAATGCTTTCAACTTTTCCCCATTCAGTATTATGTTGGCTGTGGGTTTGTC
ATAGATGGCTTTTATTACATTAAG
gtatgtcccttgtatgccgattttgctgagagttttaatcataaacgatgctggattttg
tctaatgctttttttgcatctattgagatgatcatgtgatttttgttttttaattctgtt
tatgtggtatatctcatgtattgacttgcatatgttaaaccatcctggcatccctggtat

Exon  3 +      28325      28432   2   Internal    108    72        Good
tgagatacatctcatcaatgcctaatttattgagagtttttagcatgaagggctgttgaa
ttttgtcaaaggccttttctgcatctattgagataatcatgtggcttttgtctttggttc
tgtttatatgctggattacgtttattgatttgcatatgttgaaccagtcttgcatcccag
GGATGAAGCCCACTTGATCATGGTGGGTAAGCTTTTTGATGTGCTGCTGGATTTGGTTTG
CCCGTATTTTATTGAGGATTTTTGCATCGATGTTCATCAAGGATATTG
gtctaaaattctctttttttgttgtgtctctgccaggctttggtatcatgatgatgctgg
cctgataagatgagttagggaggattccctctttttctattgattggaatagtttcagaa
ggaatggtaccagctcctccttgtacctctgatgaattcggctgtgaatccgtctggtcc

Exon  4 +      30942      31053   2   Internal    112    83        Good
cagttgattgaatcggctactgaagcttgtgcattcgtcatgtagttctcgtgccatggt
tttcagctccgtcaggtcatttaaggacttctctaccccgattattctcgttagccattc
ttctaatcttttttcaaggtttttagcttctttgccatgggttcgaacttcctcctttag
CTCGGAGAAGTTTGATCGTCTGAAGCCTTCTTTTCTCAACTCGTCAAAGACATTCTCCAT
CCAGCTTTGTTCCGTTGCTGGCGTGGAGCTGCATCCCTATGGAGGGGGAGAG
gtactctgatttttagaattttcagtttttctgctctgttttttccccatctttgtggtt
ttatctacctttggtctttgataatggtgacgtacagatggggttttggtgtggatgtcc
tttctgtttgttagttttccgtctagcagtcaggaccctcagctgcaggtctgttggagt

Exon  5 +      42068      42363   0    Initial    296    46    Marginal
tatgttttcaaaagacttttacatttgttattttatcctcaaggtgggtttataaactcc
ttctatagatgaagacttcacctgcccaaggtcatgcagataagaagaggcagctcagac
acaagttttcagaatcctagtctttccctcttttttgctagttgatgctgataattcagc
ATGAATAAGAGGACATGCTGTTTTTGTTTTGTTAAGTTCAACATTGAAACGTTGCATTCA
GTTTATGAATGCTCTGGAATAGAGCACCCTGGGACCCTGCAAATTGTATGGACCTGTGTC
ATTCATGTGTTGTCCAACTGTGGCCCATGCTGTCAGAACATGTCCAGCGCAGAACAGACC
TGGCAGGGAGTTTTCTTGCCTGACTGTTTGGCCGGTGGGATTCACGCTTTACAGCAAGCC
TTCCTCAGTGGACTGGGCTGCACCACTTGGAAAGCTACTGGAGGTGTTGGCTCCAT
gtaggatcctcgccatgctcagacaatgctgtaagagaagactcttaccagggaggcacc
tggtaggaggttggtaaggaggagacatgggtatggattgagtttaggtttccaattctg
tttacgtttgcttggtttttccattttgtatatccccacatggcatgaccagaaattgaa

Exon  6 +      42930      43039   1   Terminal    110    62    Marginal
ttacttttatgaaattgataccaaaaagcagttctgtccagtaagacaaattggcttgta
ttataatactttcattacttttctgagcaaagcaggtgcattatcagagacagccatgag
cttgtgtatatgtgtatgagtcagccttgaaaagacacaattttgagaatattttcttag
GTGAGTTTGAGAGCATGAAGCAACAAGAGCAGGAAGTGGACCAAGAGGAGGCGAATAAAA
GGTTAATGGCTTTGAAAAAGCTTTACAGGGTGCCAGTTGGAGACAACTGA
atcaatggtagttttcattttacgctgccagggagtttcttggatttttgacatattctt
cttcttttcaatcttataaacaccaagagggacaaggtggtcaaatactgtatatatagt
gttctcaccatgagtgatgtgggttgatagtagggaggagaatcaatacagtgaagctaa

Exon  7 +      44145      44249   0    Initial    105    78        Good
gggacactgaaaaattaacaatgattttttttataatatcaagtatctagttggtttttg
tactagttcattctcacattgctataaagaactacgtgagactgaataatttataaggga
aagaggtttaattgattaagagttccgcatggctgggaaagcctcaggaaacttaaaatc
ATGGCAGAAGGCAAAGGGGAAGCAAGCACATCTTACCATAGTGAAGCAGGAGAGCGAGAG
AGAGTGAAGTGGGAGATGCTACACATTTTCAAACAACCAGATCTT
gtgagagctcactaacaatcatgaaaaaagcaaggggaagtctgcccccatgattcaatc
acctcccaccaggcccctcccctgacacttggggattacaatttgacgtgagatttgggt
ggggacacagagccagaccatatcagttttcaaatgtccctgattttcatatatatgtgt

Exon  8 +      48667      48875   0    Initial    209    41    Marginal
atcaaaagcaaattagttactaccaagatacaatgggggtacaggcattggataaatgct
tccattccaaatgggagaaataggccaaagcaaaggattgttttggcccccaaacaaatt
ggccccaaaggggcaagtctgaaacccatcaggggagccattaagtcttaaagctcctaa
ATGATCTCCTTTTACTCCATGCCTCACATCCAGGTCACAGTGATGCAAGAAGTGGGCTCC
CATGGTCTTGGGCAGCTCCACCCCTATGGCTTTGCAAGGTACAGCCCTCCTCCCAGCTGC
TTTCATGGACTGGTGTTGAGTGTCTGTGGCTTTTCCAGGTGCTCAGTGCAAGCTGTCAGT
GGATCTACCATTCTGGGGTCAGGAGGACA
gtgggtgtctcttctcacagctccacttggcagtgccccaatggggactctgcgtgggat
tctaaccccacatttcctttctgcactgccctagcagaggttctccatgagggctctgcc
cctgtagcaaacttctgcctggacttccaggcatttccatacatcctctgaaatctaggt

Exon  9 +      49094      49177   0   Terminal     84    71        Good
caatggggactctgcgtgggattctaaccccacatttcctttctgcactgccctagcaga
ggttctccatgagggctctgcccctgtagcaaacttctgcctggacttccaggcatttcc
atacatcctctgaaatctaggtagaggttcccaaacctcagttcttctgtccacttgcag
GCCCAAGACCACATGGAAGTCATCAAGGATTGGGGCTTGCGCCATCTGAAGCCATGGCCC
AAGCTGTACCATGGCCCCTTATAG
ccatgactggagctgaaatgtctgggatgctgggtgccatgttgcaaggctgcacagagc
agcggggccctaggcctagcccataaaaacttttttcctccaggcttctaggcctgtggt
gaaaggggctgctgccaagacctctgatatgccctggagaaattttccccattgtcttgg

Exon 10 +      53532      55007   0     Single   1476    97   Excellent
ttttattgcatttcctgctttgcttttaatgtagcccatcctcctggaaagggcagatta
aaaataagcttggctgggcacggcaggacagagtgctaatatcatcttgtgctctttcca
ggtgcagcctgatcttcctcttctcccttgccagccagcactctgccttctgtatccacc
ATGGTGTTTGGTGAGTTTTTCCATCGCCCTGGACAAGACGAGGAACTTGTCAACCTGAAT
GTGGGGGGCTTTAAGCAGTCTGTTGACCAAAGCACCCTCCTGCGGTTTCCTCACACCAGA
CTGGGGAAGCTGCTTACTTGCCATTCTGAAGAGGCCATTCTGGAGCTGTGTGATGATTAC
AGTGTGGCCGATAAGGAGTACTACTTTGATCGGAATCCCTCCTTGTTCAGATATGTTTTG
AATTTTTATTACACGGGGAAGCTGCATGTCATGGAGGAGCTGTGCGTATTCTCATTCTGC
CAGGAGATCGAGTACTGGGGCATCAACGAGCTCTTCATTGATTCTTGCTGCAGCAATCGC
TACCAGGAACGCAAGGAGGAAAACCACGAGAAGGACTGGGACCAGAAAAGCCATGATGTG
AGTACCGACTCCTCGTTTGAAGAGTCGTCTCTGTTTGAGAAAGAGCTGGAGAAGTTTGAC
ACACTGCGATTTGGTCAGCTCCGGAAGAAAATCTGGATTAGAATGGAGAATCCAGCGTAC
TGCCTGTCCGCTAAGCTTATCGCTATCTCCTCCTTGAGCGTGGTGCTGGCCTCCATCGTG
GCCATGTGCGTTCACAGCATGTCGGAGTTCCAGAATGAGGATGGAGAAGTGGATGATCCG
GTGCTGGAAGGAGTGGAGATCGCGTGCATTGCCTGGTTCACCGGGGAGCTTGCCGTCCGG
CTGGCTGCCGCTCCTTGTCAAAAGAAATTCTGGAAAAACCCTCTGAACATCATTGACTTT
GTCTCTATTATTCCCTTCTATGCCACGTTGGCTGTAGACACCAAGGAGGAAGAGAGTGAG
GATATTGAGAACATGGGCAAGGTGGTCCAGATCCTACGGCTTATGAGGATTTTCCGAATT
CTAAAGCTTGCCCGGCACTCGGTAGGACTTCGGTCTCTAGGTGCCACACTGAGACACAGC
TACCATGAAGTTGGGCTTCTGCTTCTCTTCCTCTCTGTGGGCATTTCCATTTTCTCTGTG
CTTATCTACTCCGTGGAGAAAGATGACCACACATCCAGCCTCACCAGCATCCCCATCTGC
TGGTGGTGGGCCACCATCAGCATGACAACTGTGGGCTATGGAGACACCCACCCGGTCACC
TTGGCGGGAAAGCTCATCGCCAGCACATGCATCATCTGTGGCATCTTGGTGGTGGCCCTT
CCCATCACCATCATCTTCAACAAGTTTTCCAAGTACTACCAGAAGCAAAAGGACATTGAT
GTGGACCAGTGCAGTGAGGATGCACCAGAGAAGTGTCATGAGCTACCTTACTTTAACATT
AGGGATATATATGCACAGCGGATGCACACCTTCATTACCAGTCTCTCTTCTGTAGGCATT
GTGGTGAGCGATCCTGACTCCACAGATGCTTCAAGCATTGAAGACAATGAGGACATTTGT
AACACCACCTCCTTGGAGAATTGCACAGCAAAATGA
gcgggggtgtttgtgcctgtttctcttatcctttcccgacattaggttaacacagcttta
taaacctcagtgggttcgttaaaatcatttaattctcagggtgtacctttcagccatagt
tggacattcattgctgaattctgaaatgatagaattgtctttatttttctctgtgaggtc

--------------------------------------------------------------------------------