--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (66937 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1534       1665   0    Initial    132    63    Marginal
ccgaacccttcccaaacctcccccatcccctctcgcccttgtcccctcccctcctcccca
gccgcctggagcgaggggcagggatgagtctgtccctccggccggtccccagctgcagtg
gctgcccggtatcgtttcgcatggaaaagccactttctccacccgccgagatgggcccgg
ATGGGGGCTGCAGAGGACGCGCCCGCGGGCGGCGGCAGCAGCAGCAGCAGCAGCAGCAGC
AACAGCAACAGCCGCAGCGCCGCGGTCTCTGCGACTGAGCTGGTATTTGGGCGGCTGGTG
GCGGCTGGGACG
gttggggggtgggaggaggcgaaggaggagggagaaccccgtgcaacgttgggacttggc
aacccgcctccccctgcccaaggatatttaatttgcctcgggaatcgctgcttccagagg
ggaactcaggagggaaggcgcgcgcgcgcgcgcgctcctggaggggcaccgcagggaccc

Exon  2 +       2222       5950   0     Single   3729    94   Excellent
gctgcgtcctccttcagctgcccctccccggcgcggggggcggcgtggatttcagagtcg
gggtttctgctgcctccagccctgtttgcatgtgccgggccgcggcgaggagcctccgcc
ccccacccggttgtttttcggagcctccctctgctcagcgttggtggtggcggtggcagc
ATGGCGAGCCCTCCGGAGAGCGATGGCTTCTCGGACGTGCGCAAGGTGGGCTACCTGCGC
AAACCCAAGAGCATGCACAAACGCTTCTTCGTACTGCGCGCGGCCAGCGAGGCTGGGGGC
CCGGCGCGCCTCGAGTACTACGAGAACGAGAAGAAGTGGCGGCACAAGTCGAGCGCCCCC
AAACGCTCGATCCCCCTTGAGAGCTGCTTCAACATCAACAAGCGGGCTGACTCCAAGAAC
AAGCACCTGGTGGCTCTCTACACCCGGGACGAGCACTTTGCCATCGCGGCGGACAGCGAG
GCCGAGCAAGACAGCTGGTACCAGGCTCTCCTACAGCTGCACAACCGTGCTAAGGGCCAC
CACGACGGAGCTGCGGCCCTCGGGGCGGGAGGTGGTGGGGGCAGCTGCAGCGGCAGCTCC
GGCCTTGGTGAGGCTGGGGAGGACTTGAGCTACGGTGACGTGCCCCCAGGACCCGCATTC
AAAGAGGTCTGGCAAGTGATCCTGAAGCCCAAGGGCCTGGGTCAGACAAAGAACCTGATT
GGTATCTACCGCCTTTGCCTGACCAGCAAGACCATCAGCTTCGTGAAGCTGAACTCGGAG
GCAGCGGCCGTGGTGCTGCAGCTGATGAACATCAGGCGCTGTGGCCACTCGGAAAACTTC
TTCTTCATCGAGGTGGGCCGTTCTGCCGTGACGGGGCCCGGGGAGTTCTGGATGCAGGTG
GATGACTCTGTGGTGGCCCAGAACATGCACGAGACCATCCTGGAGGCCATGCGGGCCATG
AGTGATGAGTTCCGCCCTCGCAGCAAGAGCCAGTCCTCGTCCAACTGCTCTAACCCCATC
AGCGTCCCCCTGCGCCGGCACCATCTCAACAATCCCCCGCCCAGCCAGGTGGGGCTGACC
CGCCGATCACGCACTGAGAGCATCACCGCCACCTCCCCGGCCAGCATGGTGGGCGGGAAG
CCAGGCTCCTTCCGTGTCCGCGCCTCCAGTGACGGCGAAGGCACCATGTCCCGCCCAGCC
TCGGTGGACGGCAGCCCTGTGAGTCCCAGCACCAACAGAACCCACGCCCACCGGCATCGG
GGCAGCGCCCGGCTGCACCCCCCGCTCAACCACAGCCGCTCCATCCCCATGCCGGCTTCC
CGCTGCTCGCCTTCGGCCACCAGCCCGGTCAGTCTGTCGTCCAGTAGCACCAGTGGCCAT
GGCTCCACCTCGGATTGTCTCTTCCCACGGCGATCTAGTGCTTCGGTGTCTGGTTCCCCC
AGCGATGGCGGTTTCATCTCCTCGGATGAGTATGGCTCCAGTCCCTGCGATTTCCGGAGT
TCCTTCCGCAGTGTCACTCCGGATTCCCTGGGCCACACCCCACCAGCCCGCGGTGAGGAG
GAGCTAAGCAACTATATCTGCATGGGTGGCAAGGGGCCCTCCACCCTGACCGCCCCCAAC
GGTCACTACATTTTGTCTCGGGGTGGCAATGGCCACCGCTGCACCCCAGGAACAGGCTTG
GGCACGAGTCCAGCCTTGGCTGGGGATGAAGCAGCCAGTGCTGCAGATCTGGATAATCGG
TTCCGAAAGAGAACTCACTCGGCAGGCACATCCCCTACCATTACCCACCAGAAGACCCCG
TCCCAGTCCTCAGTGGCTTCCATTGAGGAGTACACAGAGATGATGCCTGCCTACCCACCA
GGAGGTGGCAGTGGAGGCCGACTGCCGGGACACAGGCACTCCGCCTTCGTGCCCACCCGC
TCCTACCCAGAGGAGGGTCTGGAAATGCACCCCTTGGAGCGTCGGGGGGGGCACCACCGC
CCAGACAGCTCCACCCTCCACACGGATGATGGCTACATGCCCATGTCCCCAGGGGTGGCC
CCAGTGCCCAGTGGCCGAAAGGGCAGTGGAGACTATATGCCCATGAGCCCCAAGAGCGTA
TCTGCCCCACAGCAGATCATCAATCCCATCAGACGCCATCCCCAGAGAGTGGACCCCAAT
GGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCCCAGC
AGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGACA
AACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAGC
AGCGGTGGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGAC
TCCAACACCAGCAGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCCA
GTCCTCTCCTACTACTCATTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCG
GAGGAGGGTGCCCGGCATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTCTCTAT
GCTGCAACAGCAGATGATTCTTCCTCTTCCACCAGCAGCGACAGCCTGGGTGGGGGATAC
TGCGGGGCTAGGCTGGAGCCCAGCCTTCCACATCCCCACCATCAGGTTCTGCAGCCCCAT
CTGCCTCGAAAGGTGGACACAGCTGCTCAGACCAATAGCCGCCTGGCCCGGCCCACGAGG
CTGTCCCTGGGGGATCCCAAGGCCAGCACCTTACCTCGGGCCCGAGAGCAGCAGCAGCAG
CAGCAGCCCTTGCTGCACCCTCCAGAGCCCAAGAGCCCGGGGGAATATGTCAATATTGAA
TTTGGGAGTGATCAGTCTGGCTACTTGTCTGGCCCGGTGGCTTTCCACAGCTCACCTTCT
GTCAGGTGTCCATCCCAGCTCCAGCCAGCTCCCAGAGAGGAAGAGACTGGCACTGAGGAG
TACATGAAGATGGACCTGGGGCCGGGCCGGAGGGCAGCCTGGCAGGAGAGCACTGGGGTC
GAGATGGGCAGACTGGGCCCTGCACCTCCCGGGGCTGCTAGCATTTGCAGGCCTACCCGG
GCAGTGCCCAGCAGCCGGGGTGACTACATGACCATGCAGATGAGTTGTCCCCGTCAGAGC
TACGTGGACACCTCGCCAGCTGCCCCTGTAAGCTATGCTGACATGCGAACAGGCATTGCT
GCAGAGGAGGTGAGCCTGCCCAGGGCCACCATGGCTGCTGCCTCCTCATCCTCAGCAGCC
TCTGCTTCCCCGACTGGGCCTCAAGGGGCAGCAGAGCTGGCTGCCCACTCGTCCCTGCTG
GGGGGCCCACAAGGACCTGGGGGCATGAGCGCCTTCACCCGGGTGAACCTCAGTCCTAAC
CGCAACCAGAGTGCCAAAGTGATCCGTGCAGACCCACAAGGGTGCCGGCGGAGGCATAGC
TCCGAGACTTTCTCCTCAACACCCAGTGCCACCCGGGTGGGCAACACAGTGCCCTTTGGA
GCGGGGGCAGCAGTAGGGGGCGGTGGCGGTAGCAGCAGCAGCAGCGAGGATGTGAAACGC
CACAGCTCTGCTTCCTTTGAGAATGTGTGGCTGAGGCCTGGGGAGCTTGGGGGAGCCCCC
AAGGAGCCAGCCAAACTGTGTGGGGCTGCTGGGGGTTTGGAGAATGGTCTTAACTACATA
GACCTGGATTTGGTCAAGGACTTCAAACAGTGCCCTCAGGAGTGCACCCCTGAACCGCAG
CCTCCCCCACCCCCACCCCCTCATCAACCCCTGGGCAGCGGTGAGAGCAGCTCCACCCGC
CGCTCAAGTGAGGATTTAAGCGCCTATGCCAGCATCAGTTTCCAGAAGCAGCCAGAGGAC
CGTCAGTAG
ctcaactggacatcacagcaggtgcgtttcatggtgacaaagtcagaagacaaaactgct
tttaaccttgtccttgaattctgttcttcgcctctgccccttcctgttctttcccactgc
ttcctcagggagaatgcacttacattctcagggcacacaagatgctcaccccacactgac

Exon  3 +      16948      17055   0     Single    108    46    Marginal
caatatgtaacaaaccacaaccaaataaagtgctttaaaacatcaatcatttactaggtc
acaattctgtgtgttggtaatttaggttgagttcagctgggcagttcttctgcttgtctc
atcagggtgaatgcagtggttcagtcagttggaggattgactgggggctagttgtctagg
ATGCTCTTCCTCACATATCTAGTGGATGATGCTGGCTGTCAGTTGGTGCTTGCTATTGAC
TGGTCCACGTGTCCCCAGCAGACTGACCCAGTCCTCACGTGGTATTGA
acaggttcccagcagcaagagcagggaagcaatgagtgcataaatacttttcaagcctct
gcttatatcacatttgctactatcccattgcctaaagcaagtcacatagccacacccagc
atcaaggggataaaatagagatactattagaaaatctgtattttttgacttactgtgata

Exon  4 +      32818      32935   0    Initial    118    83        Good
cagatagtaggtttctgtgttcgtggagtttttattattccaagggaagaaacaaatgat
aaccaatgaaatagtgtaaagggatagagaagaatgggtagggtgggccatttttgataa
gggtagccagaaaggaggcagtgactgagcaaacatctgagtgaagtaagggagagactt
ATGGGGCGAGGCTGTGTGCTGGTGAAGAGTGTCCCAGTAGAAGCAGCAGATGCAGAATCC
TATGCTGGGAACGATCCTATGTTCCGGTGCATCTGGAGCAGCAGGGATGGGGTAGAAG
gtgtgattggggtagtaagctagggtctcacagggcttcataggccatgggaagttgctt
gaatttcattcaaagtatgatgaaagcctgggaatgtcagtgtgtgtgcctggaccactc
accatgttactaagttttattctagagggacatggacttcttctgtgtgacgtgttactc

Exon  5 +      52848      52882   0   Internal     35    57    Marginal
catgcctgacaaatttttgtatttttagtagatatggggtttcatcatttggccaagctg
gtcttgaactcctgaggcctcatgtgatctgccctccttggcctctcaaagtgctggtat
tacaggtgtgagccaccatgcctggcccttgaggatttttttttttttttggactctcag
AGATTTGAGGGCAATGAGCGTGATGAATGGGTCAC
gtaagtaatgtgtctccttgttcactgcagccttatctcattatctccctgagctttgca
aatgattgtgaaaccaggtattttctccattttattaaactgttaatttgttgcagtaga
ctctccactgtgttgtaaggtgtctagtagtattccaggcccttacccattagaagccag

Exon  6 +      56784      56947   1   Terminal    164    70        Good
tggccccacagctgaggtacctcatggttgttttggaagatgcttgttcaattcagtaga
tttttcttacatgaccaagttcttccataaagtgaaccacaacccatattatcggggact
ctagctaaaacttgcggtgagtaggaaatagattaaacacaggttttcccacttctccag
CTGCCAAAAGTGATGTCAGTGGTGTTAATGATTCTTACCTCAGTCCGCTGCAGACCAGGG
TTGTCTATGCAAATGCTTGTTTGGTGCCTGATTCCTGGGCTATTATGGAAAAACTGATGA
TGCTTGAGAAACAATTGGGTAGTCAGACAGTTACTCAAATGTAA
aatcagacgcttgctttcttgaagcaatttgactccagggagagggcaaagaatgagaaa
tctattagtttttaacaaaaaaagcaaaggcagtgaaaataggctctgcctgattccctt
ttgtctaattatagaaacagttttgcacacaattttcaccatccatacactaaatgaagt

--------------------------------------------------------------------------------