--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8308 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1243       1324   0    Initial     82    43    Marginal
tgcctttctggttgcagcgagcatttcaaactacagagcaaggccagtggtctgttcagc
actagagacatgcagcaaggtgtcctggggtgagaagatgccataactggtcccctttct
atctccttaggtcttggacttcattccattttctgttgagtaataaactcaacgttgaaa
ATGTCCTTTGTGGGGGAGAACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGAT
GAACCCCAGTGCTGCTTAGAAG
gtaaggttcttgtagaaatctacctcagggccaaagtgtaattcctagagcagaactttg
ctaggtgctgtgcacagacccagttgtttcctgctgacttgcacagtaagtgagctttca
aatttccctggacaaataactagacaagagaaattctggaagggaaaaggaagctttgct

Exon  2 +       5359       5478   1   Internal    120    94   Excellent
cttaattgcttgtcccagcaagatagaaagcctgggagtggaagaaatattcagtggctg
tgatgtctgagcccacaggcagggtggagagctagggctggggcccttggacgtggggaa
gaaagggctgagtcttccattttcaatgtgaagtgttgatatctggtgatattgatctag
GTCCAAAGGTGAAGAACTTAAACCCGAAGAAATTCAGCATTCATGACCAGGATCACAAAG
TACTGGTCCTGGACTCTGGGAATCTCATAGCAGTTCCAGATAAAAACTACATACGCCCAG

gtgactctcagttttggctgtgttttctgcctccacctagcaggggtaaggcctcctgct
aggtgggctcaactccatgctataccatgccccatctccagcaggtggtggaagcgagga
ggagaggccccagggactagggcatcagatgaagggtctctagcaatgaccagatctgaa

Exon  3 +       6791       7039   0   Terminal    249    91   Excellent
aggattgcttatcatcccttaaataccagtaccaaggctgacacgtcatctttcccaagg
accatctgccttctctcttttcctcctctcctgtgtaaaggcctggaggatgagcacatg
tgctgtgttttcctccctctcaaagcctgtgctatctaattaatcccttttacctcacag
AAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTT
TATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTC
ATCTGCACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGG
AAACACATTGAATTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTC
AGCGATTAG
gaaactgccccattgaacgccttcctcgctaatttgaactaattgtataaaaacaccaaa
cctgctcactaaactttctgtcattgggtttcatttctcattcatgctttaaggatttgt
gtttttaggatatagcaagaagcttgtttaattacaaagttctgggttggaaagagaccg

Exon  4 +       7666       7714   0    Initial     49    41    Marginal
aaggggtagttaggtcccagataaggagcagggtgacttgacctgtgggaaaggcacaga
gacaaggaatctgggtcagatgacagccaggagaccaggtgagggaggagccaggtactg
tctgggaggcttgtcaacaagggcatggtcctatcactaagcagggctcagatcctcata
ATGGGGGAGTGGAAGGCTGGCCGAACAGAAATCAGGGCCTGGAAACAGA
gtgagggggtggagacaggagactgaggcttggaaattagtttattagttttagctcttc
agttacaagcaataataatagcttctagcttatttaagcaacaagtatactacaaaagga
gctttctagaaggatattgggtatattcatttcttactgctgctgtaacaaattaccacc

--------------------------------------------------------------------------------