--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (38521 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6879       7032   0    Initial    154    77        Good
atgcagtaatctgaaaggtcagataatcaccacatccttttctttcctactcttcctatg
acatgaaatacattctttgttatggaacagaataagtttatctctctctgcttattttct
tagtgaccttaatgaaaggagattactttgataggatttccttttaggggatccttacca
ATGACAAGTGACGATTGCATGAAAGTCAGTTTTAAAATTCAGCTGCTCCTGTTGTCTACA
TGCCCCCAGTCAAATGAAATCAGCAGCTCGGACTTCACGATAATATTAATGTGTTGCGAA
TGGGGCAGTGTCAGCTTCCTGGGTGGCATCCCTG
gtggggagcagggatggggttgatgcagaaacaccctagtccagtctgcaggggctcact
gggagccaggtggcagtgctagtggaggaagtgtgtgtctggcagccaatcgcaacccac
agctggcggcagtgagagagggcaacacggaagggctttgcattttactcatgaggtggc

Exon  2 +       9407       9494   2   Terminal     88    76        Good
gcatttgtatcctggccccatcttgtagcaagtgtgtggcctgagtgagttgtttaacct
gtctgagatttagcattctcatctgagcctaaggaaaatagtcatctcccttgcatgtac
atagtctaatacctggaactcagtaagtgttagtcttttcttccttctatcctattgtag
ACCTAAAGGGGAACTGGAAGAGCCTAAGGTGGGCACAAATGTGTCAGGCATAGAGGATAA
CTTAAAAACACGCATCTGCTGTATTTAG
caaataaatctatacatcacaggtgcagtggaagcaaacatgaaatttgaaacattttct
ctttaaaatcttcatttaaaaaatactgtattgttttccaattccagatcaccttttttt
gttgttgttgttgttgtttttttgagatggaatttcgctcttgttacccaggctggagtg

Exon  3 +      10517      10682   2   Internal    166    50    Marginal
tttttaaagttcttgctcttctgaatcaagcggaggcagagcagggtttgcacatcaatg
aatcaatctctttaataaaaataaaggaaaaatattgtaactggttactaaagggaagat
gggtgatatttgcaaagtttctgtagcattataaaatacctttacacttttattccatag
AAATTATACTCAGAAATGGAAATTAAATGTCATCAGAAGAAATAAACACAGCTGTTTCAC
TGAAAGACAAGTAACTAGTAAAATTGTGGAAGTTAAAAAATTTTTTCAGATAACCTGTGA
AAACAGTTACTATCAAACACTGGTCAACAGCACATCATTGTATAAG
gtaatgcttttataatattttaactttaagacttgatggaaaagataaaattcccaaatg
aggggctgagagctaccattctggtctcataacaaataagctgcctgatcccacatggct
cacttgccctgtttgagccaagtatcctcactggcttgttgtcaagagctgatacatagt

Exon  4 +      11879      12022   0    Initial    144    49    Marginal
aacttttgtatatatttattgcatcttactgcaatcaggcaattttgtgggttgcctgtt
tatttttttctgttttcttcagttggtataccttttacctgttgaattttaaaagctctt
atacaccatggaatactatacagccataaaaaagcatgagttcatgtcttttgtagggac
ATGGATGAAGCTGGAAACCATCATTCTCAGAAAACTAACACAGGAATAGAAAACCAAACA
CTGCATGTTCTCACTCATAAGTGGGAGGTGAACAATGAGAACACATGGACACAGGGAGGG
GAACATCACACACCGGGGCCTGTT
gtgtggggtgggagggtaggggatgtatagcattaggagaaatacctaatgtagatgaca
aattgatgggttcagcaaaccaccatggcacgtgtatacctatgtaacaaacctgcacat
tctccacatataccccagaacttaaagtataataaaaaaaaaagctcttttagaccacgc

Exon  5 +      13918      13982   0    Initial     65    65    Marginal
atggtcaaggatggccattcagcccccagacatcccatgtggtccctgcatggctctggg
acctacctctgggtgtcagatgtgctggattgaagaaagtggctttattacaattagtat
taattcctgtgacatgtatggaaatgtgtgtgagagagagagagatgtttgagtgtacct
ATGGATTTGAATATTGCTGATGCATTTCTAATCAGCTCGCTGGCTTCTGATGGAGGGTGT
CAAAG
gtgtgggtggtctgctagctactcattctctgagtaattctccacccatcccactatcca
ccccttggatgcatagtccagaatacacaaaattggactgaacatgtatgaaatagagtt
gtgactcaagcaagggtttttgaagtagtgttctctctctctctctgtctctcgctgttt

Exon  6 +      14239      14327   0    Initial     89    45    Marginal
tccagaatacacaaaattggactgaacatgtatgaaatagagttgtgactcaagcaaggg
tttttgaagtagtgttctctctctctctctgtctctcgctgtttctctctctctgcatgt
gtgtaaaagagagagatgaaagaatattgatgaaagcagctacagtgctcatattgcccc
ATGCTCTACTTCCCAGCATATATTAATAATGATAATCATGCCAACAGCAATGGGATCGCA
TTTAATTGTTTCAGTAAAAGTAGTACCAA
gtaactgggacatatgtccaggaattgctactttccattcttttttcctttttctctaaa
gatctttaactcaaaaatttggatcactgtaatatcaatttggcttttacttaaagtatt
ttaacttgttttattaaaaacagaactgtaaaaagctactactggagaacaataaaaacc

Exon  7 +      14471      14627   0   Internal    157   100   Excellent
ggatcgcatttaattgtttcagtaaaagtagtaccaagtaactgggacatatgtccagga
attgctactttccattcttttttcctttttctctaaagatctttaactcaaaaatttgga
tcactgtaatatcaatttggcttttacttaaagtattttaacttgttttattaaaaacag
AACTGTAAAAAGCTACTACTGGAGAACAATAAAAACCCAACGATAAAGAAGAACGCCGAG
TTTGAAGATCAGGGGTATTACTCCTGCGTGCATTTCCTTCATCATAATGGAAAACTATTT
AATATCACCAAAACCTTCAATATAACAATAGTGGAAG
gtaagggaaatcttagaattgggaagaaacagacgtattttagtaaaatggaattttttc
attcttcaaaactgtgtaggaattgagagtccacttagttggggttgtgaccacaccact
agttcaaatatgatggtcaaaatcttcattctggtgctcctctacttggctaaataaacc

Exon  8 +      23442      23562   1   Internal    121    79        Good
tgctacctatttcttctgctttatatattttgttttatttaaagcaaggcatatttattc
tctttctgggatggagcaccacgttttgctttaggttaacatacattgattatattgttt
tgaaacttttaagaaacctgagtttcaaaaatcagaactttagttgccaacttttaccag
GAAAAAACGTAAGGCTCAACTGCTCTGCTTTGCTGAATGAAGAGGATGTAATTTATTGGA
TGTTCGGGGAAGAAAATGGATCGGATCCTAATATACATGAAGAGAAAGAAATGAGAATTA
T
gtatgtatgtgtaatatatatgtcatgatatataccatataacaatcatatatattatat
ataacatcatattaaaaacactgggtggctgatgtgtattttgggctagtttaaattata
attataatggacatattttataattatagtggccataccctaggtggacgcattatgcag

Exon  9 +      25425      25564   2   Internal    140    84        Good
ttctgatgctccacggaggaggggacgtttattgtagtccatgctttaagagtactggcc
agaaagggaagaaataatgcaggcaacatcacagctgccttcaagcattttaaacatgtg
aattcccctctcaagggtaacgaacagagcctactgctaaattattttgccctcttacag
GACTCCAGAAGGCAAATGGCATGCTTCAAAAGTATTGAGAATTGAAAATATTGGTGAAAG
CAATCTAAATGTTTTATATAATTGCACTGTGGCCAGCACGGGAGGCACAGACACCAAAAG
CTTCATCTTGGTGAGAAAAG
gtgagaaagatttatttttggaagttttgaaacttagctcattgctactgagagacattt
caaagatggccactttctcattttccacaccagaacccagctcctgagaggggaaatcag
tcacctcatgtcacaggcattcagtggggcccctctgtctcatgatgccaagcagagaat

Exon 10 +      28620      28781   1   Internal    162    78        Good
gaaatatcactactccagactaaaggcaggaatgtggagtcactcagtggaatgtgtcag
cacgtgggttggcaactactgcattagtgttagcagtaaaaatggacaagcacgtgatga
tggacaacactggtaagatttcttgattattttcttttcctttttccctttcttttctag
CAGACATGGCTGATATCCCAGGCCACGTCTTCACAAGAGGAATGATCATAGCTGTTTTGA
TCTTGGTGGCAGTAGTGTGCCTAGTGACTGTGTGTGTCATTTATAGAGTTGACTTGGTTC
TATTTTATAGACATTTAACGAGAAGAGATGAAACATTAACAG
gtaacacatataatgctggaatttcttaccttatgttctcattaagaaatcagataaata
ggcattaatcttcatcttattgtgatgatattgtagaattaatctgtgggagaggttttc
tatgggaaatattgttctgcctgtaccatccattatgaatgttgtctatgtcttcttttc

Exon 11 +      33033      33229   1   Terminal    197   100   Excellent
ttaaaaacacattggctaattggttgcttggttagcatgggaggtttaaatataaacaac
tttatatataatttgttttttcaatgattctatactcattacttacgacattcacttaag
tttgtacttaaataaaattttatttacacatgaattaaaagagccaatcttacctcctag
ATGGAAAAACATATGATGCTTTTGTGTCTTACCTAAAAGAATGCCGACCTGAAAATGGAG
AGGAGCACACCTTTGCTGTGGAGATTTTGCCCAGGGTGTTGGAGAAACATTTTGGGTATA
AGTTATGCATATTTGAAAGGGATGTAGTGCCTGGAGGAGGTAAGAGGGAATGCCAGATAG
AAAAATATTCAAGATAG
tttctttttaaaaaatgaatgagctagcccccagagagctatcccattttccttaaaaac
aaatgaataaggtcctttaagcaagaaataaccacgtaagtcaacaatcgatagtgagaa
aacaaactaatgagcttccaatagtctcttctcttgggctctgttctttgtgcttcacgg

Exon 12 +      35605      35741   0    Initial    137    61    Marginal
tcttgcctgttctttccgagtcttaatcttcagaaacagtgaacgccaaaaagaactcaa
gatattctggggactgagcatatgaacctgttcataacaaaggctgtgactcgaaataat
taactttgtcaaaatcctgctcacaatttgaagatgaaacttgtcattaggttggcggga
ATGAGACTAAAGATTGCGCTGTGGGCTGTGGTCACGTGCTCCCAGAAGACCTGGAATTCA
AAAGAAATGGAGCTATTCTTTTTCTCCCTCTTTCATAACTGGATGCAGCTGCTCATACTC
AATCCCATATTCAGCAA
gtgtgaagctggacgtgatgcaaaataaccgatgccctacaaaaagggcgcatctttaag
agttttaatgccagtgcttaattcgaatgaggggattttaagtgtctgaagaggcatttt
ctagggaccagtgggtgactgagtaactgaaatgctgctttcactccctaacaccatgga

--------------------------------------------------------------------------------