--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (41726 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (31 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        228        358   0    Initial    131    44    Marginal
caaactagaattttggtgatgcttttaaatggaatactcttgatcagtttgtcccagctt
tccccttcagtcttggggtacatctgtgtgtctggtgcatctggggccccatagtgtctc
tggtttgtggcaggttccctgtgtgactcaagccctgtatttagagtttttaaaaaactc
ATGACCAAGATTAGAATCCAGAAATACCACCAGTCCACATCCTCTGCTGGAAAGGCGAGA
CCCTTTAATCCAGTCTACTGGATGCTCCCCCATTGCCATGAACCGCCTTCTCAGCTCCGG
ACCCATGTGTC
gtaagggcaagattattgtcacggtacgagtagtcttctccagttgagtggggtgttcct
gttactgtcattgcttttcccattttagacacatgcctcactcctgtcagcagttccacc
ttttcatggttgaggagcacatgtggtcgccagcctcccatctccagagtcccctaaggc

Exon  2 +        789        891   2   Internal    103    58    Marginal
tcctgcgatttcatgacctggtttctagatccccagtggattagaaaggactgaaggact
tttacaggctaacagcaagaagaacaaagtaactgcaaaatagacggagaattcttgaag
acggtagctcttggtcaccataagcgctgcagagaccccgaggtccacattctgttgtag
GTCAGAGCCCAGCACAACAACCCTTCTTCTGGTTCAGCCGCCCAGCGGTTATGTGGGGTA
CGGGAAAGATGATCCAGCCATGCAGGAGAGCACCAGTGGTTCT
gtgaggattttacttcaaaatagttaagtttagaagtttggcacttaaaagatcactccc
tcaggtccctggaatagttgtcctctgcaagttggagctggttcatgttttgttttaata
tgttttgtttcaagctaacgttttttttttcttccaagaaacttgcctgagtattggtgt

Exon  3 +       1201       1265   2   Internal     65    56    Marginal
tcaagctaacgttttttttttcttccaagaaacttgcctgagtattggtgttagtaacca
aagcataaatatcttgaccttttctgattttgaggtaaaaagatctgagttgtaaaatgt
agataagtaacttttctctggtttcctctctctcctctcccacttcccatcccataccag
CAAAAGCTGGCAGGCTGACAGAGGCGGCCTCAGGACGGACCTTCTGGCTACTGACCGTTT
TGCTG
gtaagtttgaccctgtctgaagacttcctgtccctgggctgtgtgtggacctgggggcgc
agggatgcgtattttcttagtcctgtgtgtaccttctttctttatatcacaccttcaagt
ttctcgtggttcgtcagagatgtctccatagcttcacctcccagcaggaaccatctatag

Exon  4 +       4849       4890   0    Initial     42    57    Marginal
attctcacaggtggtgctgggtaggaccattgttttgcaaatgcaggggtctgctctgtg
cctggcattgccatagttgtgatttttttaagtgtgttattagactctagaggacttaaa
aattgacgtagcaaggcttgctttcaagggactcaccccgttaggggagtggggctcaca
ATGTCTGAGCTGATGTTTACCAAGGAGGCCATGTGGATGGGG
gtaggttcgctgtcagagactgggagtctctggcctcctctagctctcacactcagggtg
ctgggcctggtgacctcctggggccttttcctatcactatgaattagaagagaggggtgg
ggggagttgtccttggagcatttgatggttcttgtttgtctgtttttaagcactaaaacc

Exon  5 +       5155       5294   1   Internal    140    91   Excellent
cttttcctatcactatgaattagaagagaggggtggggggagttgtccttggagcatttg
atggttcttgtttgtctgtttttaagcactaaaacccttaaaagtgtttttcatgtaatg
ctaaaagtagtgcttccttttaatctgtgttggctggtccagttgccactctaaattcag
AAGAGGAGAGCGACCCTCCAACCTACAAGGATGCCTTCCCTCCACTTCCTGAGAAAGCTG
CTTGCCTGGAAAGTGCCCAGGAACCCTCTGGAGCCTGGGGGAACAAGATCCGACCCATCA
AGGCTTCTGTCATCACTCAG
gtagaaacaccattctttcttttaaaaattttatcatgtaacatgtctatgtaaattttt
aaattttttttcttttttttttttttgagacagagtcccgctctgtcgcccaggctggag
tgcagtggtgcgatctcggctcactgcacgctccgcctcccgggttcacgccattctcct

Exon  6 +       6816       7035   0   Internal    220   100   Excellent
cttgaccttggccctttctccttgtctttcggctgctttatcccagggcttcgagcagtg
cctgtgggcagggtggggctgctttgtgagtggatggtgatgaacacatgttctttactc
cctatctgttggccttcttttaatctcttaacctttccttttttgatcttttttgagcag
GTGTTCCATGTACCCCTGGAGGAGAGAAAATACAAGGATATGAACCAGTTTGGAGAAGGT
GAACAAGCAAAAATCTGCCTTGAGATCATGCAGAGAACTGGTGCTCACTTGGAGCTGTCT
TTGGCCAAAGACCAAGGCCTCTCCATCATGGTGTCAGGAAAGCTGGATGCTGTCATGAAA
GCTCGGAAGGACATTGTTGCTAGACTGCAGACTCAGGTGG
gtagcctgaggcctacttctccccagtgactgtgtacccgttccattacccggctcctga
tgcaggctagaacgtcactggacccttcctaccagtgggacagttccgtcttttggaggt
aggacagcaacattcagagtcctctggcatttttagtggaaaaactcactaaactaataa

Exon  7 +      12943      13142   1   Internal    200   100   Excellent
gggcaaccttccccaagcatgtgatgtttaagctcatgctgttttaatggatgagttggt
gctgctgggcaggaataagcaaagatggtgtttctgccagaatgtcttggaaaaatatgc
tccttcagaacctacaaatattcttgttttcttttattctcttcttgctataggcctcag
CAACTGTTGCCATTCCCAAAGAACACCATCGCTTTGTTATTGGCAAAAATGGAGAGAAAC
TGCAAGACTTGGAGCTAAAAACTGCAACCAAAATCCAGATCCCACGCCCAGATGACCCCA
GCAATCAGATCAAGATCACTGGCACCAAAGAGGGCATCGAGAAAGCTCGCCATGAAGTCT
TACTCATCTCTGCCGAGCAG
gtgaggcctgtgtgagtgcctcgtgcccctgcctacctgcttgtgcagacctcactccct
catgggttgccgtgtccagtgtggacttcaaggcataatgtggtgggggtggagggcttg
actccaactctaaaaagccctgtctgtccccagtttgttttcaaaggcctgttctcatca

Exon  8 +      13343      13558   0   Internal    216   100   Excellent
tcgtgcccctgcctacctgcttgtgcagacctcactccctcatgggttgccgtgtccagt
gtggacttcaaggcataatgtggtgggggtggagggcttgactccaactctaaaaagccc
tgtctgtccccagtttgttttcaaaggcctgttctcatcagatcatcccttcctttccag
GACAAACGTGCTGTGGAGAGGCTAGAAGTAGAAAAGGCATTCCACCCCTTCATCGCTGGG
CCGTATAATAGACTGGTTGGCGAGATCATGCAGGAGACAGGCACGCGCATCAACATCCCC
CCACCCAGCGTGAACCGGACAGAGATTGTCTTCACTGGAGAGAAGGAACAGTTGGCTCAG
GCTGTGGCTCGCATCAAGAAGATTTATGAGGAGAAG
gtacacgatttagaggaggcaaatccccatgggcaggaatagaaatgaggatttgggtct
ggagattcagttaaggcctggttctgccccttatctttttgtccttgatgaagatgctta
ttgtctctacacttgagtgacccgggtgagatcggtgcccgcccccccttgctgttgagc

Exon  9 +      14162      14368   0   Internal    207    63    Marginal
cagtccttgaacagtgaagtttctggggattggctagtcctgatcacttgttgttcactt
cttgggatcagcatctatagtctgggccgctttggcttgctttctgcagcagtggccatg
cccacctgcccgcttcccacacctttccctttgactgccccttatggtgctcttatttag
AAAAAGAAGACTACAACCATTGCAGTGGAAGTGAAGAAATCCCAACACAAGTATGTCATT
GGGCCCAAGGGCAATTCATTGCAGGAGATCCTTGAGAGAACTGGAGTTTCCGTTGAGATC
CCACCCTCAGACAGCATCTCTGAGACTGTAATACTTCGAGGCGAACCTGAAAAGTTAGGT
CAGGCGTTGACTGAAGTCTATGCCAAG
gtaactgcctccgagcatgaagtgtgtctcctttgagtggagtccgcggggccttcatgg
atgagctctcgatttgtaaatcctggggcctggacacagtgcaggtgcccaggtttgggg
agagcgtgcctctgagccccaggtgagcagcctggctttcactgtgacacgaccttgagc

Exon 10 +      14425      14510   0    Initial     86    74        Good
ggagatccttgagagaactggagtttccgttgagatcccaccctcagacagcatctctga
gactgtaatacttcgaggcgaacctgaaaagttaggtcaggcgttgactgaagtctatgc
caaggtaactgcctccgagcatgaagtgtgtctcctttgagtggagtccgcggggccttc
ATGGATGAGCTCTCGATTTGTAAATCCTGGGGCCTGGACACAGTGCAGGTGCCCAGGTTT
GGGGAGAGCGTGCCTCTGAGCCCCAG
gtgagcagcctggctttcactgtgacacgaccttgagctctgcaaacccatggctgttct
cccattttcttaggccaatagcttcaccgtctcctctgtcgccgccccttcctggcttca
ccgtttcatcattggcaagaaagggcagaacctggccaaaatcactcagcagatgccaaa

Exon 11 +      14584      14691   0   Internal    108   100   Excellent
agtggagtccgcggggccttcatggatgagctctcgatttgtaaatcctggggcctggac
acagtgcaggtgcccaggtttggggagagcgtgcctctgagccccaggtgagcagcctgg
ctttcactgtgacacgaccttgagctctgcaaacccatggctgttctcccattttcttag
GCCAATAGCTTCACCGTCTCCTCTGTCGCCGCCCCTTCCTGGCTTCACCGTTTCATCATT
GGCAAGAAAGGGCAGAACCTGGCCAAAATCACTCAGCAGATGCCAAAG
gtaaggacacgtttttcacctgttgtattgaatttgtcttgttttctgtctttctgtttc
tgatattgctttgttgacctttgtactgtggatgcccttgaaaactggtgtatttttctg
aattaactggcctgtttgacatggtcaacttccgtgttagcttaaagaacagcagaataa

Exon 12 +      16245      16373   0   Internal    129   100   Excellent
tggctccctaaccctccctttcaactttgtttgatggctgtggatatgtccctccctccc
tcacatctatgtgaagcagtttgggatcagaagccgctccgaagagagctcccactggga
gctcaggggctgcagctgtgccattctgttttagctatctctttggttttggtgtggtag
GTTCACATCGAGTTCACAGAGGGCGAAGACAAGATCACCCTGGAGGGCCCTACAGAGGAT
GTCAATGTGGCCCAGGAACAGATAGAAGGCATGGTCAAAGATTTGGTAAGGTACCCCTTG
GAATGTTGT
gtgtgctggtgacaagggaggctctgagttgggcatgggcggtcatctctcgatgacatc
ccacatgtccgggcacagacacccagggcatcctagctgggtgagtaataggttctgaaa
caaccagaagctggtcgaagtcctggaataatcgtgggtggaggaaacttcatcttgaag

Exon 13 +      16707      16789   0   Internal     83   100   Excellent
gtgggtggaggaaacttcatcttgaagaaggcatctttcaggggagatgcaggggcagtc
tccaacaattcctgacagctgagtggtcagaaaaggcaaccgtggagactgctgggtttt
ggttcagctcattggccaagtaaccaggcgcatccatggacctctgtgctcctcctgcag
ATTAACCGGATGGACTATGTGGAGATCAACATCGACCACAAGTTCCACAGGCACCTCATT
GGGAAGAGCGGTGCCAACAGTGA
gtgaggctgtctgttgcggtggggccagtgtgccctgagacccttgtggggggtgtcagc
tgtgagaactgtgacgtccgtgcagacagtccaggcccattgctgcctgtaatgggagtt
acagactttacatcctcctgcctgctggaagaggccacttttccttttccctttggtgca

Exon 14 +      19769      19901   2   Internal    133   100   Excellent
ctggcccccattctagacaatggagatttttgtttgggaagctaagcatcgtttttggtg
atgggaatcacagataaggttatttagcgctttagcgctgtcctgcccagttatgtcatt
ggcagaatgttgttggtctgtgtcctaaatgtgtttccttttgtgttcctaagtaaacag
AATCAAAGACCAGTACAAGGTGTCCGTGCGCATCCCTCCTGACAGTGAGAAGAGCAATTT
GATCCGCATCGAGGGGGACCCACAGGGCGTGCAGCAGGCCAAGCGAGAGCTGCTGGAGCT
TGCATCTCGCATG
gtaagtgccatggctgggccctctagaaaggcactggccttgcgtctcttggccccctct
aaggagtagcgtgttgtggtgtgcggccttagagaatggaagtcgacaaatcccacgttg
cactggaaccggattggactccctggggccacatttcctttatcctccccaggtcacctg

Exon 15 +      21394      21498   0   Internal    105    86        Good
atgcgctgtgcacactcttaacagctggttgctcccggggtgctacgaggtgccacctgg
agaccacctcacctgctccatgaaggactgtgcccagggctccctggtgtccccttgtgt
cagtggggagttgctcgccgtgcttgtgataaatgacatctactttaattgtatttttag
GAAAATGAGCGTACCAAGGATCTAATCATTGAGCAAAGATTTCATCGCACAATCATTGGG
CAGAAGGGTGAACGGATCCGTGAAATTCGTGACAAATTCCCAGAG
gtaaagtttcccagagacattctgtaactctataggagtgatccaagtcacacttcagga
atatttgatatttgggatatatgtccttcctcatacttgaacttagtctccccatgattt
gttctaggtcatcattaactttccagacccagcacaaaaaagtgacattgtccagctcag

Exon 16 +      21626      21739   0   Internal    114   100   Excellent
tcattgggcagaagggtgaacggatccgtgaaattcgtgacaaattcccagaggtaaagt
ttcccagagacattctgtaactctataggagtgatccaagtcacacttcaggaatatttg
atatttgggatatatgtccttcctcatacttgaacttagtctccccatgatttgttctag
GTCATCATTAACTTTCCAGACCCAGCACAAAAAAGTGACATTGTCCAGCTCAGAGGACCT
AAGAATGAGGTGGAAAAATGCACAAAATACATGCAGAAGATGGTGGCAGATCTG
gtaggggtgtttcacatcctttcttgtatgacagcacctggggtgggtggggcatgcgtc
ctgtcagaagtcctgacccccacaggacccctgctctggggaaagcacataggccctggg
ctggccttccatctcagggacttgggacaaagtggtgacggcttctcacttaatacctgg

Exon 17 +      22859      23002   0   Internal    144   100   Excellent
ttaaaaaggtgataacttgtccgctgcatcttgcttcttcttgccttgtcctctgtagcc
ctgcaccattttggttttagactaggagggactcttccttacttctagccctgtgctcaa
ctgtgtctcaactctgggagagctctagtcagcttctcatggtgatctctctccctgtag
ATTCGTGAAGAAAGCAACACCAAAATCGACCTTCCAGCAGAGAATAGCAATTCAGAGACC
ATTATCATCACAGGCAAGCGAGCCAACTGCGAAGCTGCCCGGAGCAGGATTCTGTCTATT
CAGAAAGACCTGGTAATGGGAGAT
gttttctaatggagatcctccagtaaaatctctaacagcctctaagattgagcctggggt
tgagtcacgcagggtcattgggccagcgcaggctgatgtggaagattgcacctttcaatc
caggctactgatgagttggtcagcagttttctgcctttgtctctcacgatacttacttac

Exon 18 +      26902      26936   0   Internal     35    58    Marginal
gagcgttgactgaagaaatagagcattatgtgtggtctgaaattaccacgctcccacctc
ccaatccagcatagattcacgaggactctgggtcctgttgagttaaacacctcccagcgc
gcctgctctgctgggcgcaccccactctccccaggacgtgcactctcctcccccgtgcag
GTCAAAAATGGCTTGGAGAAGTTTGGTCAGTGCTT
gtaagtggcatctccagggctctaggcctgcgtgttcatcaccaccaaagatgatagttt
atcttttcctctgccctttttgccacaaaaatgtgacttcctcctcctgccctgtgtttg
gtttcaggccaacatagccgaggtagaggtctccatccctgccaagctgcacaactccct

Exon 19 +      27064      27282   0   Internal    219   100   Excellent
ctctcctcccccgtgcaggtcaaaaatggcttggagaagtttggtcagtgcttgtaagtg
gcatctccagggctctaggcctgcgtgttcatcaccaccaaagatgatagtttatctttt
cctctgccctttttgccacaaaaatgtgacttcctcctcctgccctgtgtttggtttcag
GCCAACATAGCCGAGGTAGAGGTCTCCATCCCTGCCAAGCTGCACAACTCCCTCATTGGC
ACCAAGGGCCGTCTGATCCGCTCCATCATGGAGGAGTGCGGCGGGGTCCACATTCACTTT
CCCGTGGAAGGTTCAGGAAGCGACACCGTTGTTATCAGGGGCCCTTCCTCGGATGTGGAG
AAGGCCAAGAAGCAGCTCCTGCATCTGGCGGAGGAGAAG
gtgagcatggggagggagcgtgactcttggcaggaagcctggtcctcagtacagtgttct
cgcttctcactgtggaaacccctgaatgcccttcctttgtggcgggtcagaaaacagctc
tataatgtactgtttatgcgtctttgtttttgctgttactggagggcctttccaggtcca

Exon 20 +      29260      29341   0   Internal     82   100   Excellent
cttgagcctggggagtggctggttttgtggaggctgatctgtagcactcgtgggaagaaa
gggagcctggcccagatttgtgtgtgcttggtctggaagcaggtagaagagtgggagcat
ggtgcacacctcttgggcagcttgcttcctgctctgctgggcacaccccacgctccccag
GACGTGCACTCCGCCAACATATCGTCCGGCGCGTTGCTCCCACCTCCCCCTGTGCAGATC
AAAAATGGCTTGGAGAAGTTTG
gtcagtgcttgtaagtggcaggaccagggttctaagcctgtgtgttcatcccaccagcat
ctggttgttgtggaagagaagtaggtgtgcagtctgggtattcatctgtttattcagtga
ggtgtgctagccccattttgggggtattggtgcaacatcaggacactggtgacaatgtaa

Exon 21 +      29549      29841   1   Internal    293   100   Excellent
ggttctaagcctgtgtgttcatcccaccagcatctggttgttgtggaagagaagtaggtg
tgcagtctgggtattcatctgtttattcagtgaggtgtgctagccccattttgggggtat
tggtgcaacatcaggacactggtgacaatgtaaggggagcccgagcttgctgtcctacag
ACCCTCTTGTCTTCCTCACTGTGGTCCAGGCACGTGGTGTCAGGCTAACACAGTGGGATT
GGTTTCTGCAGCAAACCAAGAGTTTCACTGTTGACATCCGCGCCAAGCCAGAATACCACA
AATTCCTCATCGGCAAGGGGGGCGGCAAAATTCGCAAGGTGCGCGACAGCACTGGAGCAC
GTGTCATCTTCCCTGCGGCTGAGGACAAGGACCAGGACCTGATCACCATCATTGGAAAGG
AGGACGCCGTCCGAGAGGCACAGAAGGAGCTGGAGGCCTTGATCCAAAACCTG
gtagggagcgggcctcggcggccgactctgctggggccgtgatggggtggcttatcttcc
atctcttcttaacactgcaggataatgtggtggaagactccatgctggtggaccccaagc
accaccgccacttcgtcatccgcagaggccaggtcttgcgggagattgctgaagagtatg

Exon 22 +      29922      30140   0   Internal    219   100   Excellent
tgcggctgaggacaaggaccaggacctgatcaccatcattggaaaggaggacgccgtccg
agaggcacagaaggagctggaggccttgatccaaaacctggtagggagcgggcctcggcg
gccgactctgctggggccgtgatggggtggcttatcttccatctcttcttaacactgcag
GATAATGTGGTGGAAGACTCCATGCTGGTGGACCCCAAGCACCACCGCCACTTCGTCATC
CGCAGAGGCCAGGTCTTGCGGGAGATTGCTGAAGAGTATGGCGGGGTGATGGTCAGCTTC
CCACGCTCTGGCACACAGAGCGACAAAGTCACCCTCAAGGGCGCCAAGGACTGTGTGGAG
GCAGCCAAGAAACGCATTCAGGAGATCATTGAGGACCTG
gtaggcacttgggtgctcggggaggggttctcaccccccagtggccactcaccgaagccg
tgtatgagtgttcgctccaccctgtagggaggtgactccctcatacagccctggaaggct
tcagaaggggctttctggtgctcgctcttctttcctcagcctgtctggcctccttcctga

Exon 23 +      30955      31093   0   Internal    139   100   Excellent
gacctgtcctgctacctccctcctccctgcgcctggagccctggactcgggagaagggga
gcatctgtgccaagtggctgtagaggacagggaggaaggtggtgtgaagagtgctgtaaa
acttgccctaaggaatttaatctttgctcttttcttttttctttgtgtacctccctccag
GAAGCTCAGGTGACATTAGAATGTGCTATACCCCAGAAATTCCATCGATCTGTCATGGGC
CCCAAAGGTTCCAGAATCCAGCAGATTACTCGGGATTTCAGTGTTCAAATTAAATTCCCA
GACAGAGAGGAGAACGCAG
gtgggtcccccattagccctgctctgcttgttaatagtggcgcctcccatgtgagaggcg
gggctgtcgcacatactggtgaggctctttcctgtctctgctggaaaaccatctatgtat
tctgggggcttccagaggttcagggtcactccctggcctttaaaagatggaccacgtcag

Exon 24 +      32973      33127   1   Internal    155    94   Excellent
tgtggggacgtcctatctgctctccctgaccagaccaagacctcctgaaggacaggagtg
gttttccctcccttttaccacccagcacccagcaggtgcctcacagacatatgcattctg
aacaaggtgtggggtctcttccagcagctgtcagctgtcccttttcccctttctctctag
TTCACAGTACAGAGCCAGTTGTCCAGGAGAATGGGGACGAAGCTGGGGAGGGGAGAGAGG
CTAAAGATTGTGACCCCGGCTCTCCAAGGAGGTGTGACATCATCATCATCTCTGGCCGGA
AAGAAAAGTGTGAGGCTGCCAAGGAAGCTCTGGAG
gtatgtgtccatgtgcccccctccaccccccgccaaggcccagtcagcaggcacctgggg
agacgcgtggcctggatgggatggacggttgcccaagcggcagtggcagtggaggtagcc
ctcttgctcctaccgtgtgcgcacgggctgtgcttctcggctggacacagagtttgggga

Exon 25 +      34148      34252   0   Internal    105    97   Excellent
atgcaaatcttttcctattcttttctattgagttaaaggtcctggtggcattgtcgggtg
gggcacattgctgttgtcatagggctgtttgccttgtgtttcgtggagccccattgctga
gcttacaacgtcactctgctctcagctcccacggcctaaccatgaccatcctccctgcag
GCATTGGTTCCTGTCACCATTGAAGTAGAGGTGCCCTTTGACCTTCACCGTTACGTTATT
GGGCAGAAAGGAAGTGGGATCCGCAAGATGATGGATGAGTTTGAG
gtagacccctttcccgggaggccatgtcacaggagtggcctgtcgcatcctctcccgagt
gccagtgtcctttctcaacttcctgttgactctgcctcctcctgctcggactgggcactg
acttcccttcacggcgggtggccttccctctcaccacttctgggtcccagggccaatgga

Exon 26 +      34520      34621   0   Internal    102    96   Excellent
gactctgcctcctcctgctcggactgggcactgacttcccttcacggcgggtggccttcc
ctctcaccacttctgggtcccagggccaatggactctttcctgttctctggggtcctgaa
cgtcaagtcagccccctcttcacgtaggtgaacatacatgtcccggcacctgagctgcag
TCTGACATCATCGCCATCACGGGCCTCGCTGCAAATTTGGACCGGGCCAAGGCTGGACTG
CTGGAGCGTGTGAAGGAGCTACAGGCCGAGCAGGAGGACCGG
gtgagcaggaggtggccggggcactgcccagagccatggtgctcagctttgggcacatgt
cagaatctagggaagttcttcaggatcccagcatcccagcgacatctggctggaggtgag
atgcaggcagtgccaggacgcagtcagcatccaggggtcttgctgtggaactagccaaga

Exon 27 +      35779      35922   0   Internal    144   100   Excellent
attattagcagataatggaaggtggcagaggtcggaccagagagatggcggaccattccg
gaccacgggttacagaacactgcagcatctccagtgtcctatgaccagggtggaagggga
atggagtcacagggtggatcagctcaatctttgcctcattcttgctcctttcatttgtag
GCTTTAAGGAGTTTTAAGCTGAGTGTCACTGTAGACCCCAAATACCATCCCAAGATTATC
GGGAGAAAGGGGGCAGTAATTACCCAAATCCGGTTGGAGCATGACGTGAACATCCAGTTT
CCTGATAAGGACGATGGGAACCAG
gtgagagcctcggttggagcgtgtcgggggcagaggtgcttgttgacctttcctgtgact
tgggagcagtaaccagatgtgcctagatgggggttcgagggccaagttgagagtggcaag
tctctcaggacctaattctggcttgaggtttgggctgtgtctcggtacttgccagatggg

Exon 28 +      38798      38983   0   Internal    186   100   Excellent
gcgtgagccaccgtgcccggccctgagtggacattgttaacctcttgttttaaatcagcc
gtgacgttgctttccatcttctctcctgagctgttttcctcagcagtgggggccggctct
tgcccctgacgggaatcccagtaaggcatccccttttctgactacattctccttttttag
CCCCAGGACCAAATTACCATCACAGGGTACGAAAAGAACACAGAAGCTGCCAGGGATGCT
ATACTGAGAATTGTGGGTGAACTTGAGCAGATGGTTTCTGAGGACGTCCCGCTGGACCAC
CGCGTTCACGCCCGCATCATTGGTGCCCGCGGCAAAGCCATTCGCAAAATCATGGACGAA
TTCAAG
gtgagccggctggaagcacagtgggtgagaatcctctctcaccgggggcacctggctggc
cagaagaaagagcagggcatggccttcccctcaagatgatgaggccacaaccccagggct
ggcagtggaactgtcctcatggacaccacgggtcagtgcaggcgacggcctgtgtgaggc

Exon 29 +      39473      39589   0   Internal    117   100   Excellent
gtgctcctgagatacacctaacttggtgtggtgatgaggctgactgacttcagaacaact
ctgaaaccagattttaaaacgtttgctaactcagaaaatgcttcactagaaattgacaca
taattttaacccttttcctcgcttggagtcccctcatctgacgttgtacaccccttccag
GTGGACATTCGCTTCCCACAGAGCGGAGCCCCAGACCCCAACTGCGTCACTGTGACGGGG
CTCCCAGAGAATGTGGAGGAAGCCATCGACCACATCCTCAATCTGGAGGAGGAATAC
gtgagtctctgtgggccttggagccctgaggcgccctggcacgtccaccggcctgaggcc
cagccaggagcttcaggggacaaggtggcacttgtgtttccagaggcaggcgaggtgcag
gggtgagcaggcgggcgggatgctgggggtgctgggcagactgaccctgtcttcctgtct

Exon 30 +      39781      39909   0   Internal    129   100   Excellent
tgggccttggagccctgaggcgccctggcacgtccaccggcctgaggcccagccaggagc
ttcaggggacaaggtggcacttgtgtttccagaggcaggcgaggtgcaggggtgagcagg
cgggcgggatgctgggggtgctgggcagactgaccctgtcttcctgtcttctgcctgcag
CTAGCTGACGTGGTGGACAGTGAGGCGCTGCAGGTATACATGAAACCCCCAGCACACGAA
GAGGCCAAGGCACCTTCCAGAGGCTTTGTGGTGCGGGACGCACCCTGGACCGCCAGCAGC
AGTGAGAAG
gtcagatgcgggcttctgccctcctgggtcccagggagggtgggcgggcaggcgggcttg
gtgtcctgagggtggcaactgcgtcggaagctgcttgcgagttggggagcatcccctcct
gaagccgtgtcctctctctgcacaggctcctgacatgagcagctctgaggaatttcccag

Exon 31 +      41332      41439   2   Internal    108    70        Good
ggggtgggcgccgtgtacctaagctggaggctggcgctctccctcagcacaggtgggtca
gtggccagcaggcccatctggagtgggagtgggcacttccaccccgcccacaggccatcc
ggctgtgcaggccagcccctaggagcaggtcccgggtgactggcagttttcacggtctag
GGCCGAGACGATGGCATGGGGCCTAGAGCATGAGGTAGAGCAGAATGCAGACCACGCCGC
TGGATGCCGAGAGACCCTGCTCTCCGAGGGAGGCATCTGTGTCATGCT
gtgagggctgaggacggggccctagtctctggttttctggtcttaacatccttatctgtg
tccgccacggaggtgactgagctgctagcgagttgtcctgtcccaggtacttgagttttg
gaaaagctgactcacgcccatccatctcacagcccttccctggggacagtcgcttccgcc

--------------------------------------------------------------------------------