--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (87075 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1418       1474   0    Initial     57    42    Marginal
agcagcagcagcacccgcatccgctgcgggagtccgagccggaaccacacccaagtagct
gccctttcctcttctgtcatctcaccgccccaccacagaccgcgttccccgaggaaaccg
gccgcccacgcccggagcatcctcccctgttgagcgggcgctgacggacccggcggcatg
ATGCGGCTGCGAGGCTCGGGGATGCTGCGGGACCTGCTCCTGCGGTCGCCCGCCGGC
gtgagcgcgactctgcggcgggcacagcccttggtcaccctgtgccggcgtccccgaggc
gggggacggccggccgcgggcccggctgccgccgcgcgactccacccgtggtggggcggg
ggcggctggccggcggagcccctcgcgcggggcctgtccagctctccttcggagatcttg

Exon  2 +       1418       1800   0    Initial    383    67    Marginal
agcagcagcagcacccgcatccgctgcgggagtccgagccggaaccacacccaagtagct
gccctttcctcttctgtcatctcaccgccccaccacagaccgcgttccccgaggaaaccg
gccgcccacgcccggagcatcctcccctgttgagcgggcgctgacggacccggcggcatg
ATGCGGCTGCGAGGCTCGGGGATGCTGCGGGACCTGCTCCTGCGGTCGCCCGCCGGCGTG
AGCGCGACTCTGCGGCGGGCACAGCCCTTGGTCACCCTGTGCCGGCGTCCCCGAGGCGGG
GGACGGCCGGCCGCGGGCCCGGCTGCCGCCGCGCGACTCCACCCGTGGTGGGGCGGGGGC
GGCTGGCCGGCGGAGCCCCTCGCGCGGGGCCTGTCCAGCTCTCCTTCGGAGATCTTGCAG
GAGCTGGGCAAGGGGAGCACGCATCCGCAGCCCGGGGTGTCGCCACCCGCTGCCCCGGCG
GCGCCCGGCCCCAAGGACGGCCCCGGGGAGACGGACGCGTTTGGCAACAGCGAGGGCAAA
GAGCTGGTGGCCTCAGGTGAAAA
gtgagtgtctccgcgaggcgcaggaggcctcgttcctttcggggcccgggctcaggctgt
gtggggccctgcggtggggcgggataggagccgagggtctagaaaagagaaagaaagagg
tgccgggcggcctgcgccgtctgcgccatgtgattaggcccggccccgcccgcgccttcc

Exon  3 +      20894      21023   2   Internal    130    80        Good
caactacttgaaagactgctagaaggaaagataatgtagaaagcataatttatagaattt
agttgtataaaatgataaatttatctattatttaaatagtgtcctaattattactgttat
taccaagttctgatatttgaaatgtacccagtttattaattatctttttacattctacag
ATGTGTTCAGAGCAACATTGTTTTGTTGACACAAGCATTTAGAAGAAAGTTTGTGATTCC
TGACTTTATGTCTTTTACCTCACACATTGATGAGTTATATGAAAGTGCTAAAAAGCAGTC
TGGAGGAAAG
gtaatgcttttgatgtacatattttcataaccgaatcacttaataaattcagcttaattt
gaggtctagagagtaaattgtgtagttgtgttttgctaaagaaaacactttagcttcgct
taagaaatttaagtgaagccactggatttagtgtttttacggtattttaaatatttaact

Exon  4 +      22876      22914   0   Terminal     39    66    Marginal
tctcaacttaacattggtaacccatctgtcgttgtctttgttccttgtgttcctgataaa
attagcatgagaattaagacagtgcaacataacgtatcccaaagttaaaagtcagttgca
aaacatgtaggatttcatgaagtccatgaaagcagcatttgggaattgcttacattgcag
GCACAGCTGCTGACAGATGAGGAACTTGCAGAATTATAA
aaaggatagtgatgtgagggcgctttagaaagaatgatttgatttaaaaatcaaagaatt
aagagaggcccttggaaaatggtaaagttctagaatattttttcaagaatgaccgtgttc
attgtgctgggaattagacataaagattgttatcatcttataatttggttttattagaaa

Exon  5 +      25334      25497   2   Internal    164   100   Excellent
cccacagatatcaaaggatgactgtacttaaatttattctgtaattttgacataaacttg
tggttgaattatgggaaaatttttgttggaattgttaacatgtaaaaagaataattccaa
ctatgcagttacatttttttcccagttgatgttattttttaaaaatctccttttaaatag
GCATTCTACTGGAGATACCAAAGTTCCCTTCTGTCTTCAGTCCTGTGTAAAACCTTTGAA
ATATGCCATTGCTGTTAATGATCTTGGAACTGAATATGTGCATCGATATGTTGGAAAAGA
GCCGAGTGGACTAAGATTCAACAAACTATTTTTGAATGAAGATG
gtaagaattacataaacattggttgaaaaaagaaatgtctcattttcctatgtaaatcta
agtcgttttaaacattttttgattaaaattaaaagtatttgtcatgtgatttctatataa
tccattgagagagtttcatcacctacttttaaaaatgattattttaggcatctcatacca

Exon  6 +      33523      33631   2   Terminal    109    64    Marginal
tttaattgatgaccttaaggctatttgtgatttttttttttctttcaaaattcaggaatt
tatcatggtgccattaaaatcattttcttcatgttaatccccccaccccaaaattaagta
gagtctttagtaagactcttgatttcataattttgtagtattgatattttttccttgtag
GATTGGTGGTGATCCTCAGGAAATGGGGGAAGAGGCAGAGCAAATGTTCAAAAGGATTAG
CAGATTGTGGAAAAAAGGAGAATTTGGACAGAAGGAGCCTGTTGCATAA
attcttaactactaagcttataggaaaactccaatatttaaaattttaaacaaagctata
taggtaaatacctttttaaaaacaaatgtaattttatacttaaaatgcacataattttta
aaaatcataagggtattatacttcctctctttttctctgtggtagctactaactttaaag

Exon  7 +      39401      39504   0    Initial    104    45    Marginal
agcagtcagaacatatacaacatttataggttaagttggccatcttatatggacatggct
tgtggtaccccaaaacaagtgtaatagagcaaaaatgactgatcacagatccccataaga
catctaataattatcaaaatgtgacacagagacacaaaatgagcacatactgttggaaaa
ATGGTGCCAGTAGACTTACTTGATGCAGGGTTATCACAAACCTTCAATTTCTTAAAAAAT
GCACTATCTGTGAAACACAATGAAGTGAAGCTCAATAAAATGAG
gtgtgcctgtattttcttttgctctatttacataatctgtctagagaatgttgagtaccc
aaaatgttatactgtataatgctagacattggtaaataccagttgtttcttaaaaacaac
gttaagagcaaaacttaattgtgctttaatttagtaagtcacaaaatagaccaattatgt

Exon  8 +      41354      41386   0   Internal     33    95   Excellent
ggtattaaataacatgaaaaaaagtttatataaatgttaaattactttagaactatttcc
tagatttaaaaatactaatgcagtatattataatagtagctttgaaattttgatattggc
ttgaaacttaactgtagtggtacctatattaacgtatttatgtctcttatttttttgcag
CAAGGAGTAAATAATGCTGAAAAATTTGACTAT
gtaagtgcaacatgtcattcagttttcatgccacattctctatatatttgttttttgatt
actaatattccctacttttggtttctaggtcatgcagtttttgaataagatggctggtaa
tgaatatgttggattcagtaatgcaacgtgagtgttttaaatactgttttgttacgtaaa

Exon  9 +      41475      41533   0   Internal     59    66    Marginal
tgaaacttaactgtagtggtacctatattaacgtatttatgtctcttatttttttgcagc
aaggagtaaataatgctgaaaaatttgactatgtaagtgcaacatgtcattcagttttca
tgccacattctctatatatttgttttttgattactaatattccctacttttggtttctag
GTCATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAAC
gtgagtgttttaaatactgttttgttacgtaaaaacacacaactgtatttagaattgatc
cactctcttttcattggagggaaatgaatgatttctaaattacctgacagaaacacttaa
aaatactttaaatagttttgacaaatttcttacaggtaatcatacaatcagaagagaccc

Exon 10 +      47636      47812   0   Internal    177    85        Good
taaaagtgggtaggacttcggtcaactaaaatcttcagaatgtcctcaagtttatattaa
agtaatctctttggaagaaatatttcagatctgtatgaaataccaaataaaatagattat
cttaaaagtgaacagtaatattaaaagtagtatgagaattctgctttttctttgtgttag
CTGTGCTCCATTGAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAAT
GGTGGTTTCTGCCCAATTACTGGTGAAAGAGTACTGAGCCCTGAAGCAGTTCGAAATACA
TTGAGTTTGATGCATTCCTGTGGCATGTATGACTTCTCAGGGCAGTTTGCTTTCCAT
gtaagtaattgtttaatcttattttctctggcaagaaactagtctgaactggttctttta
aaaatgcagtttgaactttgcttctaaagctgtatattaatttttgagagagaggcttgt
tttcaaggttaatttgttacaagattagtaaggaatagagataaggtctaccagatgttc

Exon 11 +      51830      51967   0    Initial    138    86        Good
atttgattggctgagccctaggatcatgttagtaagcagtgttcttaaaacttatatcca
tatcttactctgattttagttctcttcttgatgcattatactactttattagcatgtagt
gatgatttctaggctggacgatataagcagagtttgttaaaatatggatatatataacca
ATGAATAGCCAATTTCTTATACCTGCTCTGTATAACTGTTTACAGGATCTTGTTTCTCTG
TGTAATTTCCATAACTATGATAATTTGAGACACTTTGCAAAAAAACTTGATCCTCGAAGA
GAAGGTGGTGATCAAAGG
gtaagcaaaattcttatttagataagtatataaaatttttaagaagagaaaaagtgagat
ttgcctgtataaataaaatcttagtttgttagtggcctcgggtctttgctaatcataaat
gagtgtaaacaaattgttgacatataaatccgggatcaccagtattaaatacttaaagat

Exon 12 +      56039      56090   2   Terminal     52    78        Good
ttggttgtactagaagtatttgaataaaaacttttctctcaatttttttggtggtttttc
catttggtaactttaaaaaaagtgcaaccctatttgtaggttatttctgctttctgagga
ggaatattgttgttattcactatgtaactctcattttatctgttgttgcctaaataatag
GAAAAACATTGCTAAACCAAATGAAGAGTATCATCATATTGCTTTAGAATAA
aactgttaatctcagtagaatttatattaaacagaatgacagtgatacagaaattcacct
taactggtttctgaggggattacattttcagaaggaattttgtatatttccacagcatga
tccaaattatagtacaaattatagaggctccatgtattgtaggtcaaatatagtacttta

Exon 13 +      62026      62087   0   Internal     62    66    Marginal
tataatgataatgatagaaaagtaaaaaaatgctaggagagggtacaataagaacttgtt
ttgtctgggtggttaaatatggttggttttcactggaaggtaatacagtgtgtaagtttt
gaaggagtcagaggaaatatggaatagtgttaataggctagtctgacttgaaggccccag
AACAGGAAGGAGTTTAGCACATTTGAGAAGGGGAAAGAAGAAGGCAAATGCGCTGAAGAA
GA
gtgaggtgaggtggatggagattggctgtggatgactcctaagagatggggccatattat
gtagagtgggccttctcatatttcgatgtacatcagaattgttagagtgtcttaatttta
aaatacagctagcttcctggggcccattcctacagttggattcaaaaatctaaatgttta

Exon 14 +      73895      73956   0   Internal     62    76        Good
taaaagaagaaagtatcacacacgtgggttcttttggctatggaagtgtccttgagatca
ctttttgcacgtgactcagctgaagtgttcaaagcacatggaaatcacttgccagtgaca
ggtggacgttgtatgtgttttctctctcctaaggatgcctaaactttcttttcttcacag
GTAAAGTCAGTGATAAATCTTTTGTTTGCTGCATATACTGGAGATGTGTCTGCACTTCGA
AG
gtatgtttacaggatggattagcatgcactttacagatatttatgaagttgcttctgggc
gagcagccattttaaggttaaagtctcacttttctttccctttgataaaaatgaccccaa
caaaatttttattaaataggcacttccagtgccttaggcctgctttccaatcttgtcctt

Exon 15 +      74914      74990   2   Internal     77    62    Marginal
gtgaagtggcatctacccaaaacacctgtgtactggttaataaggtcggtagttcccatt
aatgagcttgatgaaggatggcacctgacagggccttaaatgaactgatggagtgaatgt
taccagtgtgaattaaatttgctttatatataataaatagctgtgcttacacattttcag
ATTTGCTTTGTCAGCTATGGACATGGAACAGCGGGACTATGATTCTAGAACAGCACTCCA
TGTAGCTGCTGCAGAGG
gtaatacaggaactactcctatctattttctttccagatttaatttctacttagtactaa
aatctgctctttttttgggggtgggacggtataggtcatgttgaagttgttaaatttttg
ctggaagcctgcaaagtaaaccctttccccaaggacaggtgagcacttatgttaccttct

Exon 16 +      78078      78144   2   Terminal     67    68    Marginal
tttgagatacattccatcaatacctagtttattgagagtttttagcatgaaggtgtgttg
gattttgtcaaaggccttttctgcatctattgagataattgtggtttttgtcattggttc
tgtttatgtgatggattacgtgtatcgatttgcatatgttgaaccagccttgcatcccag
GGATGAAGCCGACTTGATCGTGGTGGATAAGCTTTTTGATGTGCTGCTGGATTCAGTTTG
CCAGTAG
tttattgaggattttcgcatcaatattcatcagggatactggcctgaaattttctttttt
tgttgtgtctctgccaggttttggtatcaagatgatgctggcctcataaaatgagttagg
gaggattccttctttttctattgtttggaatagattcagaaggaatggtaccagctcctc

Exon 17 +      79987      80057   1   Terminal     71    74        Good
ttattttgtccttcagttgatgcagtttcttcatagtgtcaatggtctttacaattttgt
atgtttttgcagttgctggttacccctcgtggagtttttaacaacccagggtagacaaga
caaacctttagagaagcataaactttaagatgataattaacactgaatgttctctcttag
GATTTGCAAAGAAGCCAGTGATTGGTGAGGACAGTGATTGCTGGCAGGGATTCGACATTT
ATGCAGCCTGA
tgttgtttttaataataatgtgaattttatcagcatacaaacttgctcacaatattgaga
catacaaaatgggaaggcttctaaacaagctaaaatgtataagaaaactgttaactctaa
aatgaatatattggagtttgttgaaatttctgcatttggttggaatcagtttcagaaggc

Exon 18 +      82183      82293   0   Internal    111    88        Good
gtcacttaattcagctgttttttttttttttttgataaatacaaagatacatgtaaagtt
ttacttacctgattttaaaaacaggctaccaaaatttatccaaatatattaaaaaatgag
actgttttaaaaacctttcgtttccatattgtgactccactaagcgggtaaaaagttcag
GACAGAGATGGAAAGGAAAGAAGGAAACAGGAAGAAGTGAAACTAGGAAGGTGGTGCCAG
TGGCACATGGATGAAGAAAGAGAGATCATCAGCCATGGAGAATTTTGTAAT
gtaagtagagagagagattgggtaggaagacaggcttcacagtttgtaaagtgtaaggga
actacccatcgtaccctgtcattgactagggctgtgagttatgtagttctgtctcctctt
gcaaaagacttaccacttctggcaagtgattaaccacttctggcaactcttcatttcttc

Exon 19 +      83160      83316   2   Terminal    157    76        Good
gagactactttttgaattataaatccctttctgcatttctattattaatttttatttgta
aaattgctaaaatagctaaatttggccatttaacctgcatttaaaatctaggaatgtggg
gtgatcatctttgtacataaattacctaatgaccctgtccatgctgtgctacgtgtttag
GTGGAATAACACTCCCATGGATGAAGCACTGCACTTTGGACACCATGATGTATTTAAAAT
TCTCCAAGAATACCAAGTCCAGTACACACCTCAAGGAGATTCTGACAACGGGAAGGAAAA
TCAAACCGTCCATAAGAATCTTGATGGATTGTTGTAA
tggtctcaaatcccaagatttaaatcacttacctatttaattgtggaaaatgattatgaa
gaacatgtgtatttctatctggtagtgatgtatattttacatttgtcatttcagtgttac
tggagttttcttcattgtgcacacaggacaaatctgatctctttgggaaaaaatagaaat

--------------------------------------------------------------------------------