--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19379 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2094       2216   0   Internal    123   100   Excellent
tggctagccccttcttttcagaaaggagcccaaacctttagtatcgatgtcagtgatcta
cacgctgtgttaacagagttaacagtagtttgatccattgcggtgtgggtagaatataat
atattttctatttgttttttacctaaaaagagaaattgtgttttactgattttaatatag
GACTTGACTTTGGGCTATGGTTGTGGTCTTCAAAAGAGTTACTCCTACCCCTTGGAGTTC
ATGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTTGTGGTTGTGGTTGTT
GTT
gttgttttaggatatgaatttccaggtcctcaacttccacacatacttgttcctaaaatt
gatttgctttccttaagacttgcctcaatcccctctggcaccgtccactttgtaatgcct
atgcctcctcagtccttaaatttaggaaggaagtttaaggtacctaaggaaagtaaagcc

Exon  2 +       4639       4803   0   Internal    165   100   Excellent
ttgaattatgtcttaatgtaggacatctaacattttgtagttaaaatttttgtgataaga
ttataagcttttggtaactgtttactttttgacggacttctaataatttcttttaatcca
actttcatagataataggtagtatttatattactaaccttctcccctttcactattatag
TTTGGAAATTTTAGCATTCAGGTGCCAGGAATGCAGATGGGACAGCCAGTGCCAGAAACA
GGCCCAGCTATACTCCTCGATGGATACTCTGGGCCAGCATATTCAGACACTTATTCCTCA
GCTGGTGACTCCGTGTATACTTACTTCAGTGCTGTTGCTGGACAG
gtgagatgctaaatttattgcataaatatgtctttaaaattattgtttaagagaaatgtc
agctatttagagtatcattttaaatgtatatgaaatttatattttatatgtatctagact
aatttttttcctgagatcagagatgagcatagtcataattatttcattttaaaagtctgt

Exon  3 +       9399       9468   0   Internal     70    80        Good
ggtatgatattttgtaatatgcctttgttgtcagtaattatctctagaattttgtagtta
attatagagtaatgtttcaaagaatgcatatgtcttgattggcctagaacagtcaattga
cattttaatatgcttttatacaactgcacattaaattaggtcataattatttttaaacag
GATGGTGAAGTGGATGCTGAAGAACTTCAGAGATGTTTGACACAGTCTGGAATTAATGGA
ACTTACTCTC
gtgagatcttttttccccttttgttgaaattataataggaagtttattttcttacttttt
ttgtccctgtaattaaaatgtttaaaaaattatcacagttatacatgcacatagtttaag
gagtcaaataactgtaaaactcgttatgaaaataactgttcattgtgtattcctgtctcc

Exon  4 +      13837      13966   0    Initial    130    92   Excellent
gtaagatcctgtttaaattctaggctttctagtttttatgcagaagtctgttcatataat
gagtttggctaagtctacagaagcatactcatgttttagtcaatgatttagagtcagata
aactcaggtatcagaatttatttttgttaataaaactatcagagagatcacacaggaaaa
ATGGGATTTAATGCATTCAAAGAGCTATGGGCAGCTCTTAATGCCTGGAAGGAAAACTTC
ATGACTGTTGATCAAGATGGAAGTGGCACAGTAGAACATCATGAGTTGCGTCAAGCCATT
GGTCTTATGG
gtaagaacattaacattctttagaatctataaagctaatctttgttctttgattagatga
acttaattgcttcaatttactaactaataaagggatgtatttttttgccagcaagttcct
ttgtttgttttcaaggttgtaggtaaattctgaccaaagacctcaacaaaaccattttaa

Exon  5 +      16105      16218   1   Internal    114    65    Marginal
cgattaacaggattaacagtgaagcctttgtctgatgaatttcaatattcatgtgttttg
tttctaattatatttttgtggaatgaattttgaaagttattttatgacttaatgagaaag
caatcttgcagtgttcttatgttatttacatttagaagttttaatttatctcttttttag
GTTATAGGTTGAGTCCTCAAACATTAACTACTATTGTTAAACGTTATAGCAAGAATGGCA
GAATTTTCTTTGATGATTATGTTGCTTGCTGTGTGAAGCTTCGAGCATTGACAG
gtattgactatttaaaactaagtgcacagtgttatgtagctatttttcttgaataatgtg
tctcatttcctccagcaagtttataataatatgtgttttctccctttattcactgttaaa
tctaattagtttaaaggcttcaaatattaaggaatataaatgataaaaacgttatgttat

Exon  6 +      16565      16613   1   Internal     49    66    Marginal
aaacgttatgttatttttggaagtttttctcatatctctgttgccagggctattcaatca
cttaatatttaattgaatatgaaattattctttttgtgtacctgggtgcactaaatattt
gaaactatgtattttaaattacaataaaaaagtaatttctttgtttaaagatttctttag
GAAAAGAGACCACTTGCAACAAGGGTCTGCGAATTTCATATATGACGAT
gtgagtatcctgcttttgatatttatactgcattctagatagttctcagttagtaaaaaa
atttaagtgatcccaagtaccagtactggaaataatatatttggtatgccacatactttt
ccatatttttcagtgtaacacaaatataagattaatattggtataggtgccaaacaattt

--------------------------------------------------------------------------------