--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (46977 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6726       6788   1   Internal     63    94   Excellent
ggcttagagtatatgcctgtcggctcacagatttggctcctagctcctttcaggaagtag
cttttaatgaagagctctggcaaagtcctcatcctcccccaagaaaaccattgtcctcca
cccatttccccgcggtcggaacctccctaaccgaacctctctccctctctctcgtcctag
CGTACGATACCTGGTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCT
GCG
gtaagtgacaggacccactggggcccggctgggtggcgcggcgggcggacctttggggct
tgggagactgggacgcaagcggagggggatccgggctcatgggtctgattttctaatgta
attacagccaggacagccagcgaccacgctcccctacaggccctgaccctcctctgcccg

Exon  2 +       8348       8447   2   Internal    100    77        Good
gggagtttggccttctccccagcgcaggacgcccgtggggcaaggccagggctgcatccc
tgtgctggggcagccggcggccgcggatctttgttctataaatagccccgtcccactccc
acccccacctccacccccaccctgccgccattctgggcttaatggcccgtttcgcgccag
GTCCCTTCGGCGGCCGCAGCGCTCGGCTTCTGCAGCCGTCATTGTCATGCAGCCAGCCGG
GCAGGCAGAACTGAGCGAGCCCTGGGCAGCCGAGGACAGG
gtaggggcaggctctgggcgacggctccttaccagcggcgcctggcctgctgagggtggg
gggcagccctcattcacccccatcctgccccctgctgtcccctgctcctctggctgcagg
cgctccacttccgcgggaataaaaggtctaagtgcttcttatggggacatacccgacgag

Exon  3 +      12029      12181   0   Terminal    153    48    Marginal
cagttgaattgtagtcctgggaagcaaagctgaattctccagattaacttgcctttttgc
acctcttgggactttcttccaagtctgccttgtgacacgtgtgactccgcaagtttcttg
gtatttacagaaacagctttggggtcaccaagaagcttagaacctttttcctcttttcag
TGTGCTGCATTTTGGGCTAAGACTGAGGCTGAATTGAAGGAGGAGAAGCCAAAGGAAAGA
GCAGACGTGCGGGCCAGGAGCCCCACAGGGGATGGTGGAGATGTGGAGGGAGTGTGCTCC
ACGCTGGCAGGTTCTCCTGCCCTTTTGGCTTAA
ccctctttccccgtttgctgccggagtttgtcctgctcaccttgggcaggagaactttcc
actcactccgaggggcagaggtgaggcactgagaatcccgccctgggctcagatccctcc
tgtcatctctgtggagttcttggatgactagttttattccagcatttgtcaccatctgcc

Exon  4 +      14114      14272   1   Internal    159   100   Excellent
ctgcccccctccctgcctgaaggcgagcagtgccagagccactgtatttaaaacacagac
actcacttcttttctcaggagaaacaagagccctgcttggagagttgattcactctgcag
ctgaccctcaggggctgggcagtttgcagcactctctctgaccagcttcttgtgccatag
GCTTCTTGCAAAGGACCAACAGCCTGGAAGAGAAGAGTCGCCTTGTGAGTGCCTTCAAGG
AGAGGCAATCCTCCAAGAACCTGCTTTCCTGTGAAAACAGCGACCGGGATGCCCGCTTCC
GGCGCACAGAGACTGACTTCTCTAATCTGTTTGCTAGAG
gtagcccctgccccactcccgccccatgctagccagtagatttcttatttgagtttcttg
actttttcctgcaattttacttcttttatcaagaaatgtcattattctctctgaacccac
atgaaactgcttttgtgactttgggggaatataattgactccctccctccctgctggcca

Exon  5 +      15589      15814   1   Internal    226   100   Excellent
caaaacttctgtgtatgtgcatttttctggagatgtggtatatccgattctcagtgcaca
tacatatcccagaatgaaatcaggcctatacagatagcatggttaatattaggggtctct
gggctgaagaaatctagatatgagtcaggtgaaaaccattcattgctctccccaattcag
ATCTGCTTCCGGCTAAGAACGGTGAGGAGCAAACCGTGCAATTCCTCCTGGAAGTGGTGG
ACATACTCCTCAACTATGTCCGCAAGACATTTGATCGCTCCACCAAGGTGCTGGACTTTC
ATCACCCACACCAGTTGCTGGAAGGCATGGAGGGCTTCAACTTGGAGCTCTCTGACCACC
CCGAGTCCCTGGAGCAGATCCTGGTTGACTGCAGAGACACCTTGAA
gtatggggttcgcacaggtaaggaggagagttgggtagacaggtagtggcaactttgccc
tccatctcacccttgccagttgtgaggatatcaaacttgtgttggaagaaaaacacagcc
ctggtgagataaggcggcaaagtacccagtgaccacaagaacaagcttgggcagtaacag

Exon  6 +      15894      15937   2   Internal     44    86        Good
ccacaccagttgctggaaggcatggagggcttcaacttggagctctctgaccaccccgag
tccctggagcagatcctggttgactgcagagacaccttgaagtatggggttcgcacaggt
aaggaggagagttgggtagacaggtagtggcaactttgccctccatctcacccttgccag
TTGTGAGGATATCAAACTTGTGTTGGAAGAAAAACACAGCCCTG
gtgagataaggcggcaaagtacccagtgaccacaagaacaagcttgggcagtaacagttg
gtggagggacccgacccaggcaaaagttcatcagcatatatcatggtaaaagtagataaa
aaagatataaatgcttggtgctaggtcaagttctgtataaagagttttcattctggccaa

Exon  7 +      21432      21522   1   Internal     91   100   Excellent
ttaatgttggtatagggtgggtcaacctgcccttcctttttcaatatccttgagcagcct
tattcgacatatcactgggatggaagccccatcagtgtgacccagtggggcaggccgttt
gccttcaagataggttgagaaatctgcatttgccttgatgcttttctgtttcctatctag
GTCATCCTCGATTTTTCAACCAGCTCTCCACTGGATTGGATATTATTGGCCTAGCTGGAG
AATGGCTGACATCAACGGCCAATACCAACAT
gtaagtctcatatgttttcatataagcaaccctgatgtatgactatggcttgttgcttta
aaagttcagtcccagtggttctattttattaaagtttccctggtcattttttctcttaaa
atctttaggtttatcacagttctgatttaatggtaaatacttgataaactattgttgaat

Exon  8 +      24307      24436   1   Internal    130    88        Good
cctgtaatcccagctactcaggaggctgaggcaggagaatcacttgagcctgggaggtag
aggttgcagtgagctgagactatgccaccgcactccagcccgggcgacagaacgagactc
catctcaaaaaaaaaaaaaaaaatctatgtccatgcctttacacctgtttctgcacatag
CTGTGCAGTATATTCTTCTTCTAAGCAACGACCCAGTGAAGATCCAAACAAAAGTTCACA
AATATGTAGTTATCCAAGGCACATACAGCTCTTTTCTTCCAGAACAGGGCCACCAAGCAC
AATTGCGCAG
gtagggcccgagtgtaaacaacagcctgccctcaaacatctaatggcaatacataatctt
aatggcaagatctatcataaccctttgctatgaggttatgatttcaagtatctagcactt
tattttcatagaaaatatccaggagaaattctctatgggagttattcatcattttacacc

Exon  9 +      28684      28796   2   Internal    113    81        Good
ggtttctgacattttatgatcggcgacttaatgcatttccaggaaatgaatcatgttagt
ggtttggaacagcttttttttagaacccaactacaaatactaaaccaatcctctgtgttc
ctaaaataagtggtttgacttctttattttctttcatccttcttcttaccacctttccag
GTTTACATATGAAATTGCACCAGTGTTTGTCCTCATGGAACAAATAACACTTAAGAAGAT
GAGAGAGATAGTTGGATGGTCAAGTAAAGATGGTGATGGGATATTTTCTCCTG
gtaggtttctcttctcttcctcttctcaaggtttgggattcttaagaatacaaaatatga
agtaggtttatggaagaataatgccttaacattttttttggataccctgacttcctattt
tttcaagatgaaggctaacaaaaatgctacattctatatgaattaactaacaaaggctat

Exon 10 +      30145      30293   1   Internal    149   100   Excellent
ttcccagggtaaagggtccagtgggaagccccagcaatagggaagccagcaaaacctatc
aggatattatcctttcgcttcctgacctcccttgtctcttgagacaccagctcagcgttc
gtttttagaaacaataatcaaagagccccaacacctcccaatatgtccgcttgctgacag
GGGGCGCCATATCCAACATGTACAGCATCATGGCTGCTCGCTACAAGTACTTCCCGGAAG
TTAAGACAAAGGGCATGGCGGCTGTGCCTAAACTGGTCCTCTTCACCTCAGAACAGGTGA
GTCGGGGATGCTTTCTCATGGATAGTGGT
gttttttaggggactttccaacttctaacctcgagcctctgtttgttgcagagtcactat
tccataaagaaagctggggctgcacttggctttggaactgacaatgtgattttgataaag
tgcaatgaaaggtaggcaggggagggtgaatattaggttcttgatgtattaaatgtgttc

Exon 11 +      30345      30424   0   Internal     80    69    Marginal
tacagcatcatggctgctcgctacaagtacttcccggaagttaagacaaagggcatggcg
gctgtgcctaaactggtcctcttcacctcagaacaggtgagtcggggatgctttctcatg
gatagtggtgttttttaggggactttccaacttctaacctcgagcctctgtttgttgcag
AGTCACTATTCCATAAAGAAAGCTGGGGCTGCACTTGGCTTTGGAACTGACAATGTGATT
TTGATAAAGTGCAATGAAAG
gtaggcaggggagggtgaatattaggttcttgatgtattaaatgtgttcatctgttaaat
ttgttttattgtgcttaaggactggctcagtacattgtgccaagctgctaatggtctgtt
gaaaatatccgattaaattgctttttgctgctgctaaagtttttttcatgtgcaatctca

Exon 12 +      30648      30702   2   Internal     55    95   Excellent
gtgttcatctgttaaatttgttttattgtgcttaaggactggctcagtacattgtgccaa
gctgctaatggtctgttgaaaatatccgattaaattgctttttgctgctgctaaagtttt
tttcatgtgcaatctcattgactcttcattttaatttccctccttttccaataattatag
GGGGAAAATAATTCCAGCTGATTTTGAGGCAAAAATTCTTGAAGCCAAACAGAAG
gtatgtactccgtggtgcatctgaactccagttttaaaataccttctttctgtcctagac
aaaaacagtccttgataatatgagacaattttcttgtgcttctaaaattctattcttcaa
atttgcttatttccaactagtaaaataatttggttttaaagctgtgtctacacaatatca

Exon 13 +      31268      31333   0   Internal     66    87        Good
tgcttccatgccctggcagatggcccatggtacttggcacatccagcctcaacaaactct
attaaacaaaaaaactcacagaacagatgtatccacaagtcagtgccaggtagctgtcag
gccacttaccaacacatggttgtttcagttacattcttatacctccttctctaattgtag
TTATTTGCTGGGGTCTTGGCACAGGAAGTGGATCTAAGTGTTGTAAAGACTGAGCAAGGA
GCAGAG
gtggagctgagcttcacaaaagcctaagaggcagggcatgggggctcgcacctgtaatcc
cagcactttgggaggctgaggcaggaggatcccttgagcccaggaattcaagaccagcct
gggcaacatagggtaacccacatctctgtaaaaaattttaaaaaatagccaggtgtggtg

Exon 14 +      32315      32431   0   Internal    117   100   Excellent
gaataaatgaatgaatgagtgaatgagccaacaaaacactactagacatagtatctggta
atacataagttttgccatttactgttagaaataaatgttacacaattcttcttcctgtga
aaatcagcaaatgagaaaggttaaaaatactcatcagcctatatctgtcttaccttgtag
GGATATGTTCCCTTTTATGTCAATGCAACTGCTGGCACGACTGTTTATGGAGCTTTTGAT
CCGATACAAGAGATTGCAGATATATGTGAGAAATATAACCTTTGGTTGCATGTCGAT
gtaagtgctatataactcaggccagtccatgtggggggtggaggcacctcttttttatga
cttgcctcaagcttctccccacgccccagccagccctctctccacaccacattagttcca
gttcttgtctggaccctagccagccattcacaactggtacacaccacagacctggaacat

Exon 15 +      33519      33803   0   Terminal    285    48    Marginal
attggccaataggatcatctgccttgctactgaactaatgactaacaaaggctgtgtcac
gtggcatcccaactattcagtaaacatgcatcatggtacccacaaaaatgtcttgttgtt
acataagttgttgtgagacctccaaacccagcaggaactgctgctttttgagtttttcag
GAGCTGTTAGAATTCTACTCTGGGAAGAACCAGACAGCAGGCCTCAGTTTTTTGAGCAGC
TTCCAGAGCCACCCGGAGGGGGACTCACTGTGTTGGCTTTCCACAACACATTGGGCTAAT
GGGCCATTGGACCTTTGGGTCTTGGCAGAACAGGCACCTCAGGCTCAGACCTGGCCTAGC
TGTATCACTTGTGCAGCTAAAGTCCAGAGGAACTTTGAAAAAGAAATGACAAGCAATGAA
GAATCACAACTGATTGAACAATCAGTGTGGGCTGAACTTTTCTGA
gaaacttatgtttttcaccttgtactttcttgctcatgttttagtagaagtgaggactga
ctagttttagattcttaaatgtcactgctcccctcttcctctcctttctctgtccccaca
ggctgcctggggaggtgggctgctcatgtccaggaagcaccgccataaactcaacggcat

Exon 16 +      33925      33989   0   Internal     65    91   Excellent
tgacaagcaatgaagaatcacaactgattgaacaatcagtgtgggctgaacttttctgag
aaacttatgtttttcaccttgtactttcttgctcatgttttagtagaagtgaggactgac
tagttttagattcttaaatgtcactgctcccctcttcctctcctttctctgtccccacag
GCTGCCTGGGGAGGTGGGCTGCTCATGTCCAGGAAGCACCGCCATAAACTCAACGGCATA
GAAAG
gtaacggccagaactcgccaggcctccttccacccagcacatcaaacagaccatgctctg
atgtcagcctgcaccaccctgccctgatccccagcatcatatttcggtctaagtttgctt
cagttcagcaggcatttgttgagcatttattggatgactgatttcccagtcaaatgagtc

Exon 17 +      37353      37464   2   Internal    112    81        Good
ccgtaatgtaatactccgagactgcctgcaaaacatttgtttgctacttgattagtcaat
tcaggagaataggcatggataatatttactaacttgagttggaatgggtgttttcctcaa
gagaacagttgcgtctttccaactcctgcaccttctcgaagtctcatgtgcttctttcag
GGCCAACTCAGTCACCTGGAACCCTCACAAGATGATGGGCGTGCTGTTGCAGTGCTCTGC
CATTCTCGTCAAGGAAAAGGTCTGTACTCCCTCCAAAGCTACACTGGGGCCC
gtacgttctttagaaagcacaaaaagacacacgtggggtctctttgcagtacttgttggc
tgactcacgagattggcagccccactgagagactactgctgctgtcctttcctgcccttg
cagctaacctggtttcttctcttggctcttgctggctactgtgcttcttctttgatcagt

Exon 18 +      38512      38661   0   Internal    150   100   Excellent
ggcagtttttccaagagtgattttagaaaagggcatcagaacaagtgtaaggcctcataa
agacatcagaagaaagattgcatatgaccccaagcccctccttccaagcagcctagtttt
aaagccacccacatctctgatgtgtaaatgcagatgcacccatcttaatttccatgatag
GGTATACTCCAAGGATGCAACCAGATGTGTGCAGGATACCTCTTCCAGCCAGACAAGCAG
TATGATGTCTCCTACGACACCGGGGACAAGGCAATTCAGTGTGGCCGCCACGTGGATATC
TTCAAGTTCTGGCTGATGTGGAAAGCAAAG
gtatgaagggaatagttcaggaaatagagcagaaatgtaatttgcacagactggctggca
aaagaggggcaaagatatatcacagataattcactatatggggaatcaatatctagataa
ttgaattaactgtgttttctttgtgaatgaaattactttattccttatgtcaaattctct

Exon 19 +      41657      41793   0   Internal    137   100   Excellent
cacatcatttattgcatgcacatctgtgaaaaagctgacatatttgattagattgttctt
cctaaccagctccaaaaatactttttttgtttatttcccatagacagggacagcatagcc
ttcccaaatgctcatcacagggaaatgcaaccacaaacatgacttttctctttaaaacag
GGCACAGTGGGATTTGAAAACCAGATCAACAAATGCCTGGAACTGGCTGAATACCTCTAT
GCCAAGATTAAAAACAGAGAAGAATTTGAGATGGTTTTCAATGGCGAGGTAGGTAATCAT
CATGGACCAGGTACACA
gtatttccagaaaaactgctgagggaagctcctgaagcttctggcaacatgggaaaatca
atcccatgttgccagaaactgcttcaaaatttttattcttatacactcttaattcctctc
tttaattccttccatgtctatgaacttttcttctggtagcactgggatgactttttcctt

Exon 20 +      43443      43532   2   Internal     90    61    Marginal
atatgattggataaatgaggcattgttctccctggtgtggaagtaacattgcctttgaga
tgaacattcaacctctttctttggtccaagagacttccaccaaggatgcatattggtttg
ggaacagctttctctcaagttatcctaattttctttgtttgtcttttaaaatctctgcag
CCTGAGCACACAAACGTCTGTTTTTGGTATATTCCACAAAGCCTCAGGGGTGTGCCAGAC
AGCCCTCAACGACGGGAAAAGCTACACAAG
gtatggacttgctttttgtctcatctaatcctctgcaatttctctggctggtcaggacat
cctcattccaatgtgcctttctagtgggggaaatataaaaaataaagccttggggtgggt
ttctagtaatggggtggtggggagccatcctgttatattcctcttgagcctgcatcgccc

Exon 21 +      44372      44521   0     Single    150    89        Good
tttgatattagcccctgaagattcctggatatgaaatatttctttgcttttatgtcaatg
taaacacaaatagtaaaatgcaagttgggttgaattgttaaaaagagagggtgttcatat
caatcttgagttttgttttgtgttttccatcacaaggtggctccaaaaatcaaagccctg
ATGATGGAGTCAGGTACGACCATGGTTGGCTACCAGCCCCAAGGGGACAAGGCCAACTTC
TTCCGGATGGTCATCTCCAACCCAGCCGCTACCCAGTCTGACATTGACTTCCTCATTGAG
GAGATAGAAAGACTGGGCCAGGATCTGTAA
tcatccttcgcagaacatgagtttatgggaatgccttttccctctggcactccagaacaa
acctctatatgttgctgaaacacacaggccatttcattgagggaaaacataatatcttga
agaatattgttaaaaccttacttaaagcttgtttgttctagttagcaggaaatagtgttc

Exon 22 +      44844      44947   2   Internal    104    61    Marginal
taaagcttgtttgttctagttagcaggaaatagtgttctttttaaaaagttgcacattag
gaacagagtatatatgtacagttatacatacctctctctatatatacatgtatagtgagt
gtggcttagtaatagatcacggcatgtttcccgctccaagagaattcactttaccttcag
CAGTTACCGAGGAGCTAAACATGCTGCCAACCAGCTTGTCCAACAACTCCAGGAAAACTG
TTTTTCAAAACGCCATGTCCTAGGGGCCGAGGGAAATGCTGTTG
gtgagaatcgacctcactgtcagcgtttctccacctgaagtgatgatggatgagaaaaaa
caccaccaaatgacaagtcacaccctccccattagtatcctgttaggggaaaatagtagc
agagtcattgttacaggtgtactatggctgtatttttagagattaatttgtgtagattgt

Exon 23 +      45884      45958   0   Terminal     75    72        Good
agaagggaaattcacactgtgcgttttagagtatgcaagaagaatataaataaataaaaa
tattctccatggagaatttgaacaaaattttcttctagtttgtgtttcatacagagatgt
ttctaattagagttccttgggttgcccatagcccatttgctttctattggctgactttag
GTGATGCTCAGTACCCTGATTAAGCTGAAGGAGACTCGATCCACTGTCACAGGCTCTGAA
GCTCCTCATCTATAA
aatcattatgggctgggcatggtggtgcatgcctgtaatcctagcactttgggaggctga
ggcaggcagatcacttgagctcaggagttcgagacccatctgtgcaacagggcgaaaccc
tgtctctgcaagaaatgtaaaaattagccagctgtggtgatgcgcacctgtggtcccaac

--------------------------------------------------------------------------------