--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16320 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        357        441   2   Internal     85    62    Marginal
tttctagattcctgaatgtattttttggtggaggaggaactcaaagtagaattcatttac
atattcattcattcattccacagcactaatcactccatgcagtaactgtgtgtccccgtc
cctctcagacttagtacctggaagacagccaacctgtcttaattctattggtatccccag
GGCGCATTTCTTTGCCTTGAAAATTGAGTACCCAATAAATGTGCGTCGAGCAGAACTACA
CGAGATGGAGAACAGGGGTTTAGGG
gtatgggggagagtcagcaattactggtgtcctccctccctcccccagctctgctcctac
agatccaggacgcctagcgagggtaggaacctcttctgtgcttccgcaacgctctgaact
gcacggcactgagcgcatctaattaaagtgatggtttcattagatagcaacacagcgaga

Exon  2 +       1293       1329   0    Initial     37    64    Marginal
gccccgccgcccccttgccagtggcccctccccgcgcaggtcccgactccagccgcacct
cctccggctctgcagtggcggcgaggaggcgagccggagcgacggcggggctggggccgg
agccgagccggggtcgggcagcagcagggaccccccagaggcggggcctgtgggaccgct
ATGGGCGTGGAGATCGAGACCATCTCCCCCGGAGACG
gtaccgggctccctccggagccaggggaggggaggggtcccggggcggagcccggagggc
gggggtctgattcggaggtggcgtggagggtgctgaagggtcggggggctggatggggaa
ggcaggcggagacgccggacgggattcttgggggtctaggagaccatcctccgccatcct

Exon  3 +      12257      12369   1   Internal    113    99   Excellent
atgtgggggtgaggcagaaggaagtgtccagatttcctgcttgggcaacaggatggatgg
ggaggatcggaagaggagcaggtgtgtgcagaaaaggcattccattttagacatgtggaa
tctgaattgggagtttactcatgaccacagctctattgcacccgattcttgctttgacag
GAATGCTCCAAAATGGGAAGAAGTTTGATTCATCCAGAGACAGAAACAAACCTTTCAAGT
TCAGAATTGGCAAACAGGAAGTCATCAAAGGTTTTGAAGAGGGTGCAGCCCAG
gtaggatgaggattcgcattaaaggggatctggggagttggggatctgggatcagcactc
tgccctccacctccaccttcacccactcacagaccactactgctttgactctacagccag
ggcatggcaacgccatctggtgtcccctcctggctttgcgtccccacccctctccttgcc

Exon  4 +      14507      14631   0   Internal    125    97   Excellent
gaatctgcgtttgttaaagctgttagcacgatttcaatgtatcccatgtaaaattcatct
gagatcttcagagttaacattgaggatggtttgggaaaatgccatagtcatctaactttt
ttcttttaaatcaagctgggtcctctttctcctctccccatctgcccccatccctgctag
ATGAGCTTGGGGCAGAGGGCGAAGCTGACCTGCACCCCTGATGTGGCATATGGAGCCACG
GGCCACCCCGGTGTCATCCCTCCCAATGCCACCCTCATCTTTGACGTGGAGCTGCTCAAC
TTAGA
gtgaaggcaggaaggaactcaaggtggctggagatggctgctgctcaccctcctagcctg
ctctgccactgggacggctcctgcttttggggctcttgatcagtgtgctaacctcactgc
ctcatggcatcatccattctctctgcccaagttgctctgtatgtgttcgtcagtgttcat

Exon  5 +      15147      15225   1   Internal     79    74        Good
aggtgctcagacatgaaatgtacatggcgtaccgtacacagagggacttgagccagttac
ctttgctgtcactttctctcttataaattctgttagctgctcacttaaacaatgtcctct
ttgagaaaatgtaaaataaaggctctgtgcttgacaaactcctgtccatccttattttag
GTAGGAAGTGCTCTAAGGACCACACAAGCCAGGTGCCCTTGGGAAAGAGTGGAAAGAAAG
GAGGGTTCCAAGTGGCTAG
gtgagtgataaatataatagctacaatgtgagcattttacatgctgggccttgttctaca
tacttttttattttatttatttatttatttatttgagatggagtctcgctctgtcactca
ggctggaatgcagtggcacaatcttggctcactgcaacctccgcctcctgggttcaaacg

--------------------------------------------------------------------------------