--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (8370 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1136       1250   0   Internal    115    54    Marginal
gcctgggcatgctgggaactgtagtctaaagggcaagagccacctgtccggatagggagc
ccaaagtggagttggccctcattgcaacccgtagtgcggggcggggcctcggggcccgtc
ggaaattgtagtccgattggggctgcgcgcttcgcttctgcggctcagcctccagcccag
GTGGCGCTGTGGACCCTGCAGCCGCGGAGCGAGGCAGCGGGGCGGCTCCGTGACCACGGC
GGGCGGAGCCTAGGACTGAGGGCGATGGCTGCTGTGGCCGTGGCTGTTCGCGAGG
gtgagtgaagagccgggcctgcctactggtacgcggagccgacgagctccggacagctag
tgccgggccttgagcgcctttgggccccgccgctccgttccagcgccacgctgggctccg
gtctacacagtctcgagcgcagtcccgcgccgcgcaccggctggttgctgtgaggagggt

Exon  2 +       1985       2120   0   Internal    136    94   Excellent
tatgattctgtccctggaggagaaacgtcagcctctgtggatgtaagcttgcaacaggta
gcttgtggaagttaggaagaactagggatttaaccatgtggaaatcttgtaagcatccaa
tagtatttgttcccctttggaattgttggggaagagcagtatcctatgtctgtgtctcag
GCAGTGGGGAGGGAAATGACCAAAGAAGAAAAGCTGCAGCTTCGGAAGGAAAAGAAACAG
CAGAAGAAGAAACGGAAGGAAGAAAAGGGGGCAGAACCAGAGACTGGCTCTGCTGTATCT
GCAGCCCAATGTCAAG
gtgagtgaggggtctcttttaaagggctggggtgtggagctggtagagggatgtggtggg
agagataagggagagacaggacaaagttgatttgagcaagtgtgtaaagcaaagaggttt
acaaggagagaagctagttttagctggggcacggatatcacctgcctgcagcttgggcat

Exon  3 +       2322       2548   1   Terminal    227    52    Marginal
aagggctggggtgtggagctggtagagggatgtggtgggagagataagggagagacagga
caaagttgatttgagcaagtgtgtaaagcaaagaggtttacaaggagagaagctagtttt
agctggggcacggatatcacctgcctgcagcttgggcatttttttttttaatgcttttag
TAGGCCCAACCAGAGAACTGCCAGAATCGGGCATTCAGTTGGGCACTCCTCGGGAGAAAG
TTCCAGCTGGTCGGAGTAAGGCCGAACTTCGGGCTGAGCGTCGAGCCAAGCAGGAGGCCG
AGCGGGCCCTGAAACAGGCAAGAAAAGGGGAACAAGGAGGACCACCTCCTAAGGCCAGCC
CCAGCACAGCTGGAGAAACCCCCTCAGGTATCTTCCCTTCATTTTAA
gacctcccttactcctaattataacgccagctcaggctgcccaatagtaaaacagctctc
ccctctcattcttgggacccagagttctgaattgttcctgcaaccccattatcctatccc
tatttccttttctaccctattctcccgttttctccacctcatcctgtttttcttgatgcc

Exon  4 +       2801       2880   1   Internal     80    73        Good
tgggacccagagttctgaattgttcctgcaaccccattatcctatccctatttccttttc
taccctattctcccgttttctccacctcatcctgtttttcttgatgccccttatacccta
agagcaaattacacatttcaagacctacagtgtcctgaaaacatgatgattatctttcag
GAGTGAAGCGTCTCCCTGAGTACCCTCAGGTTGATGACCTACTTCTGAGAAGGCTTGTTA
AAAAACCAGAGCGTCAACAG
gtaggaagtgggtttggtgcctggctagaaagagcctagggaaatggactggagggagga
aaggtgctgggtgcaaagtgagaaggataggtgcttgggtcagagtagtcttactgttca
cttcctttccagctttatcccatcctttttaaactctgggccattggtcctgttcccttg

Exon  5 +       3421       3523   1   Internal    103    73        Good
gagatggactctgtaggaaaaagtatgaacccaaggcagaactgtagaggagtggggaaa
tctgctagtgaagggagttccttttcatcaggggcaggtgggcagtagatgctcaagctc
cctttcaaagtatgtgacaccgccatcccatcagcatcccatcctctgtgatccacccag
CCATGGTGCGACTCGGCCTGCAGTACTCCCAGGGCCTGGTCAGTGGCTCCAATGCCCGGT
GTATTGCCCTGCTTCGTGCCTTGCAGCAGGTATGTCCCATCCT
gttctctcttatgatccaaccccacctcccccaatactaccccagcttctgtcacccaag
gtcatctctgggggacagagggaatactcctaccctcagaacattttcctcagtgaagct
tacccccagcccccgttcagagatctttattaaggggtattttgcagatcaccttgtgta

Exon  6 +       3948       4077   2   Internal    130    94   Excellent
taaactaaaaccctacatgaggtagggacaacactataagtccactcccagctcgcccaa
tctttgtcttgtactctttttcctgcttttctatctctcttttcattttgtgttctattt
tctttttaaagactttttttttaaatgtgaaggctttgtaagttgtgaagagttgcgcag
ATATAAGGTATTGCTGTTGTATTATAGCTTCCTGACTCAGTGCCGTCCCCTGTCAGCGAG
CATGCACAACGCCATCAAGTTCCTTAACAAGGAAATCACCAGTGTGGGCAGTTCCAAGCG
GGAAGAGGAG
gtgatgagtatgagaaataaggaaggcatgcacctgtgggtaaaattaagaaacatgtta
aaaactcccgggaaggccaacgtaagcctttttttgccctagtcaagggttaaggaatgg
tttggccattctgacttgtgccatctctgagccctctataggcttgtcatcatacacata

Exon  7 +       4333       4495   0   Internal    163    95   Excellent
gccaacgtaagcctttttttgccctagtcaagggttaaggaatggtttggccattctgac
ttgtgccatctctgagccctctataggcttgtcatcatacacatattcaagcacctggca
tgatcatcagagggataaaagtgtccatttcttgttcactaaggattttactccatttag
GCCAAGTCAGAACTTCGAGCAGCCATTGATCGGTATGTGCAAGAGAAGATTGTGCTAGCA
GCTCAGGCAATTTCACGCTTTGCTTACCAGAAGATCAGTAATGGAGATGTGATCCTGGTA
TATGGATGGTATGGTCCAGACCTTGTGACTGAGCAGATTGGGA
gttggaatgatctgaagaagggactacccacttgcctttgggaataagttagtcatcagt
tactgacatttataactgaatcctcctcttcattcactctagctcatctctggtatcacg
aattcttcaggaggcttggacagagggccggcggtttcgggtggtagtggtggacagccg

Exon  8 +       4598       4775   2   Internal    178    87        Good
accagaagatcagtaatggagatgtgatcctggtatatggatggtatggtccagaccttg
tgactgagcagattgggagttggaatgatctgaagaagggactacccacttgcctttggg
aataagttagtcatcagttactgacatttataactgaatcctcctcttcattcactctag
CTCATCTCTGGTATCACGAATTCTTCAGGAGGCTTGGACAGAGGGCCGGCGGTTTCGGGT
GGTAGTGGTGGACAGCCGGCCATGGCTGGAAGGAAGGCACACACTACGTTCTCTAGTCCA
TGCTGGTGTCCCAGCCTCCTACCTGCTGATTCCTGCAGCCTCCTATGTGCTCCCAGAG
gtaagtacagaggaaaaggactccaaagttggcggtgaaaaggtgtagtagtatagacat
aatctcaccttcccaaagttacagttttgtttttgttttgagataaggatggagtgcagc
gacgtgatcacagctcactgcagtcttgacctcctgggctcaggtgatcttcccacctcc

Exon  9 +       6636       6816   0   Internal    181    77        Good
atctcaaagaaaaaaaaaaaaaagatttattacttgttgtctgtttttgtttctttccct
tcttttcacaggtgttgagatttattacttgtcttaatgttgctgtcctgtaagtagggg
accttattttgcattgatacaacaatgacatttttttcttcctcttctcctgtgaaacag
GTTTCCAAGGTGCTATTGGGAGCTCATGCACTCTTGGCCAACGGGTCTGTGATGTCACGG
GTAGGGACAGCACAGTTAGCCCTGGTGGCTCGAGCCCATAATGTACCAGTGCTGGTTTGC
TGTGAAACATACAAGTTCTGTGAGCGTGTGCAGACTGATGCCTTTGTCTCTAATGAGCTA
G
gtaaggaggcaaaagagaagcctccagctacctgtgaagacttgagagggagggagaggg
gcggataaactagaacttcttttctgaaagaacataatgggtacgccttccattgcagat
gaccctgatgatctgcaatgtaagcggggagaacatgttgcgctggctaactggcagaac

Exon 10 +       6935       7090   1   Internal    156    90   Excellent
ctgtgaaacatacaagttctgtgagcgtgtgcagactgatgcctttgtctctaatgagct
aggtaaggaggcaaaagagaagcctccagctacctgtgaagacttgagagggagggagag
gggcggataaactagaacttcttttctgaaagaacataatgggtacgccttccattgcag
ATGACCCTGATGATCTGCAATGTAAGCGGGGAGAACATGTTGCGCTGGCTAACTGGCAGA
ACCACGCATCCCTACGGTTGTTGAATCTAGTCTATGATGTGACTCCCCCAGAGCTTGTGG
ATCTGGTGATCACGGAGCTGGGGATGATCCCTTGCA
gttctgtacctgttgttctacgagtcaagagcagtgaccagtgacgggggaaacacaggg
ttaataaatgccatactccctaccctcagcaactctgctgcctttgtttctcttttagca
tctccaccacttaagttaggagtccagacttcacaaccccttttatcacctgctactcag

--------------------------------------------------------------------------------