--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (73233 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1503       1810   0    Initial    308    60    Marginal
tcaggtggcagcggcagaggccgggctgagacgtggccaggggaacacggctggctgtcc
aggccgtcggggcggcagtagggtccctagcacgtccttgccttcttgggagctccaagc
ggcgggagaggcaggcgtcagtggctgcgcctccatgcctgcgcgcggggcgggacgctg
ATGGAGCGCGCCATCAGCCCGGGGCTGCTGGTACGGGCGCTGCTGCTGCTGCTGCTGCTG
CTGGGGCTCGCGGCAAGGACGGTGGCCGCGGGGCGCGCCCGTGGCCTCCCAGCGCCGACG
GCGGAGGCGGCGTTCGGCCTCGGGGCGGCCGCTGCTCCCACCTCAGCGACGCGAGTACCG
GCGGCGGGCGCCGTGGCTGCGGCCGAGGTGACTGTGGAGGACGCTGAGGCGCTGCCGGCA
GCCGCGGGAGAGCAGGAGCCTCGGGGTCCGGAACCAGACGATGAGACAGAGTTGCGACCG
CGCGGCAG
gtgaggggctgccgacccgggggaggcaacttgtttacgcgcgcgagccgcggaggatgc
ggtgtaggggggcggagatccgggacccgggcgggcgtcttccctcggctgcggagggca
gctggcgacctggggacgagcgcggggccacgacgccctcccatcccccggccagcgacc

Exon  2 +       1867       2052   0    Initial    186    50    Marginal
cgggcgccgtggctgcggccgaggtgactgtggaggacgctgaggcgctgccggcagccg
cgggagagcaggagcctcggggtccggaaccagacgatgagacagagttgcgaccgcgcg
gcaggtgaggggctgccgacccgggggaggcaacttgtttacgcgcgcgagccgcggagg
ATGCGGTGTAGGGGGGCGGAGATCCGGGACCCGGGCGGGCGTCTTCCCTCGGCTGCGGAG
GGCAGCTGGCGACCTGGGGACGAGCGCGGGGCCACGACGCCCTCCCATCCCCCGGCCAGC
GACCTGCCTGGGCTCGGCTCCCGAGGGCCTGGTGCTGGCCGACGGGTCAGAGCAGCATCC
TCGCAG
gtgcgggagaatggaattccagggttgcaaagaaacgccacttcccctctttcattgttt
tcgggcattgattctcttccaaggaacctttccctctttttccttacgcacatcacctcc
tgtctgtgctggcgtgacagctgttttgagaaaggactttagcaaaagacgtctgcattt

Exon  3 +       4209       4308   2   Terminal    100    72        Good
aaggtaaggggtttggtgttggacatgtgactcggaggtgcaggcaggacatccagaggg
aggtaggcgggtggaaatgagtgactagagccagtgagaaggcagcataaatatgaatag
gtgaagctgtgggaaagggaaagctcatgagaaaacctcaggaaatgccttttattttag
GGAGGAAGATGAGCCAGCAAAGGAGACAGAAATACAGCTGGCTAGGTTGGAGGTACAGGA
GGAGGACTGGGAAGAAAGATTTGGCGATGAGCACACTTAA
agagtttaaatgaagcagcagagacaatactcaaattgcaagaggttaaagattcaggcc
cttctgccccaatccctcctttcctcactgatgaggtaatttttaggagaaggaacctcc
gaacttacttatgtactgaaaagagggagcctgtgtagatagaatgaaaatgaaaggggc

Exon  4 +       7595       7666   0   Terminal     72    68    Marginal
aataaaagttcctttaaaatgattttatgaagaaatttagcatacacttatcagaatttg
ataaacttaactgtaaataggcaggtgttctgggtaacttaagtcagcacagtttttctt
tttttattgcgtattcattgtggcataaagtcatttctcctggattgaggacataatcag
AGCAATTACAGGATGAACGACATCTATGAGATTTCTGAGAGGAATAAAAAGCTGCACGTT
TTAGTAATATAG
tagttgccacttatgcaaacttacagttaacagaataatgagttaaaaacctgaatttct
gctcctgttcaaaattttgtatttggtgcataaccttaggtaaatcacatcttttcccat
cttctcagcctttttggtggtgattgttttgtgtagataatatgtttgtcctaccaaggt

Exon  5 +       9885       9961   0    Initial     77    75        Good
ggttgccattgagcagagatcgtaccattgggcgacagagcaagactccgtccccccaaa
aaaaaaaaaaaagaatgatagatgaggacccaggagggactggtcctgtagaaaccagga
aagaaaaatgtccagaatgaggagctggccacaacggtggcttttgtgaagacaggcctg
ATGAGGGGAGTGAATCTGGCAGTTAGGAAACCATTGAAAATCTTTCTTGAGAGTGGCTTC
CAAGGATTGGATCATGG
gtgagagttcagggcttgctgaggaatcatccaaataaatgcttttgtaagctacagcaa
aatgtaagtgagagacagaagtctccaaagtatttactgacagagatgttcaatatgcct
tcttcatccacatcataaatttaatttttctctatggaaatgactaaggtaaaacagtgt

Exon  6 +      12804      12903   0    Initial    100    88        Good
tatgagactggatgagatcaccaaaaaaattacatgtaggtagagactattttaagagat
aggaaagataagaaggaaccagaaaatgaaactgagacagaatagcatagaactgagtcc
aaaaaaaaaagagcgtggtgacctggaagccatatagagtgtgtttcatggagggcagaa
ATGGCTGGTCAGGTGCTGCTGGGTGGTCAAGTGAAGCAAGACCTGACCACGGGATTTATC
AGTGTGAAGGTCATTCTTGACTCTGACAAGAACCATTTTA
gtgaggtggtaggggcgagaacttgattagaaatagttcaacatagaaggagaggaagag
attaggagacagtatataacaactctttcaaggagttttgttgcagaggggcaagaagta
gattggatgcttgaggaggagaaggattcattttgtttgatctggtttggtttttaagtt

Exon  7 +      13172      13233   1   Terminal     62    47    Marginal
caaggagttttgttgcagaggggcaagaagtagattggatgcttgaggaggagaaggatt
cattttgtttgatctggtttggtttttaagttggggaaaatagtagcaggtttgaatgct
gctataacaaaatactgtagactgggtggtttatagacaacagacctttatttctcatag
TTCTAGAGGCTGGGAAGTTCAAGATCAAGGTACTGGCAGATTCAGTATCTGGTGAAGACT
GA
ttcttcacagaagcactcctacatggtggaaggggcaagggcatctctggggctgctttt
ataaaggcattaatatcataagtgaggaccccaccttcatgaactaatcacctcctaaag
ccccacctcctggtatgatcaccttggggattaggtttcaacttatgaattttttggtgg

Exon  8 +      13904      13980   2   Internal     77    85        Good
tgaaagagctggcatcagaagtttgaggaacagggagacatgaatggttaacatggttca
gtggcataatggatagactagggaagggtgttatgattgttgagcattgttagtagcctt
tttgaggttggtggtcgttaattaaagtgaggatagtcaacatggtatgtttctcttcag
ATACGTTCAACTGCACAGATGTAGGAGTGAGAAAGGGGAGAAGATTGACTTTAACCAGTT
CTTCCAGAGTGTGACAT
gtgagaggcagggtagggagttgaggtgtgtgcaaagtagtgcttaagatgaaggactgt
gggattttaactggttaagaaagaagtgagggcatggtggtagtgaaggttgtagtatca
gtggcttgtaggttctcatagggtcagaagtttcttggagtcagggaagtagaggaagtg

Exon  9 +      14924      15053   2   Internal    130   100   Excellent
taaagggcatattgaaattgtcttggtccaaagacagtggtggcaagagtggtagaaggc
cccctcttcctttctacgaatagaggcctggacatgggctggttttcttttgagcatgtg
ggataagtgcccaatatcttagatatctgttaattttaaaaatatttttaatatttacag
GTCATTAGTAATTATCAGCACTTTAGATGGGAGAATTGCTGCCTTGGATCCTGAAAATCA
TGGTAAAAAGCAGTGGGATTTGGATGTGGGATCCGGTTCCTTGGTGTCATCCAGCCTTAG
CAAACCAGAG
gtaagaattttctgttaactgttgactagaaaacttaattctaatgagtaattgctgata
ttaagaagtttggggccctattgcccaggtttgaggcctgtctgcctcttacagtttgtg
tccctttagggcaattacttaacttttctattcctcagttcccctcttgtgaaatgagat

Exon 10 +      15953      16159   0   Terminal    207    52    Marginal
gcttttctggagctttagtctgttgtttaaattacttaaaaataagtccatcttttgagt
ggtgactactaacattgaagcagtcacctctgttttccagaatgcctgtggccttctttt
atatcgagttgttcttgtaggacactccctagggtagtcttttttctcttttgtcatcag
TCTTTTTCTTTAAAAAGCTTCCTAGCTGATATTAAGTATGGAAAAGACAAAATCGTACAT
GAGGGGTTTGAGAATGACCTGAATATTGGTGACCAAACTTTCCAATGGGAAACTGCTACC
AGTGACGCATCTATAATAACAGACTTTCCTGTGCTTTCCAGTAAACCCAGCCCAAATCTT
TTCTGGTGCACCCAAACTGATATTTAA
ggaaacaacactgccaaatttccacatttgctgtgtgctgaaccctgagtagactttata
agtggctactgtttctcagtatactgaaaatatattttgagaatagagaacttctattgt
attatgaattattaatacaaatagcaatttgattgtaaattacattaagtttataattga

Exon 11 +      19326      19546   1   Terminal    221    60    Marginal
gtgcttttcctcaagacatgctttagcatgtggagaaaggcttgttacatacttcctaat
tagtcatgcagaataataaaaagatgtgttactcagggtcaagatttaatgaaatcagtc
atttttattgcttcatcaagaacatttgtaagtggaactgtctctgtttttttcctttag
TTCAGGTGTATGACAGTGAAGAATACCATTGTATTCTTAGTTTGGTTCCTGAATTGTGCC
AAGGCACCGGCAGTTTTAGTCAGCATTGCTTTTATACCTTCAGGGCAAATAGCAACCTTT
GTGAAAAGGCAAATCACACCTTGTTTGAAAACTGTGTGCTATTTTGCACCCCTGAAAGAA
TCCACGAACCATACTTTGAAAATTACTTAATTGGTATATGA
tagaaatataagaatatttgtgaaattataaacatattagcaaggagagaagactgtatt
gtgagcatgagtcatctgttattcagcaaggtgtgtgctgctcagcatctagaagttatg
ttcaaaagttgaacatttgtccagttcagatttagaaaaaaaaaaagttggacaaaacac

Exon 12 +      24444      24523   0    Initial     80    43    Marginal
gatagagcacaaagaaagactctaacaagcataagtgcttacctagcctgatggtcaaag
aaggcctctcttgtatgatcaggagttactgaggcaagagatggatagagaggaggggga
ggattatgctgggagaggaaatagcctatctcaaggccttaaggcgagagttatcatggc
ATGTTTGGGGAACTGAGAGAAGTTGAGGATGGCAACAGGAATGAGGGTTGGGAGAGAGCA
GCCGAAATGAGCCCATTGAG
gtgggccaggatcaggttatgcagggtctagtaagctatgttagacattccagattttat
cctgagccatgagaaaccattgaaggtttaagtggaagagatcactctgactgtagaaaa
tggactgaaacaacagcagaaattgggagactatttctagtctcccacactagttaagag

Exon 13 +      33114      33308   0   Internal    195   100   Excellent
gatggactgcactgcttcatgtgctactcagaaggaggctggagtacatcaggatcaaga
ctccagctcttaattactattattcttttaaaggtatgatgcttctatttttctgggaga
aataagaaaaaaataataattaatgttatggcccttttaaaaagttagcttctgttttag
GTATTTGGGAATAAGATGATCATTCCTTCCCTGGATGGAGCCCTCTTCCAGTGGGACCAA
GACCGTGAAAGCATGGAAACAGTTCCTTTCACAGTTGAATCACTTCTTGAATCTTCTTAT
AAATTTGGAGATGATGTTGTTTTGGTTGGAGGAAAATCTCTGACTACATATGGACTCAGT
GCATATAGTGGAAAG
gtaagtgaaaatgctgaatttactttggggaaatcagagtaaattagggtagaaaaagta
atttattaaactacacttattattagttgagttttattgtaattttcccctgaggttgtc
atttgttttaataagagaactgtgaggtaggaaggggaaactaataacagaataaatggc

Exon 14 +      34781      34864   1   Internal     84    52    Marginal
ttgcatttttcaactttaacaattccttatctaagtgttaggcccatagcactttcttgc
tcttgcagatgcttttctgccttctccacccacctgcatctgcattgtgttgaggaggcc
atgccatcctatctggccgttttttgagcaaagcacttcaatctctgtttacttcggtag
TCTCATCTGTAAACAACAGGATTGAACCCGATCACCTGGTTTTCCGATTTGATGTGCTGC
TACATAATTCTGGTATTGTAGAAG
gtatgcttttcgtgaggattttagtttggatcatattaactcttccttttttctttagtg
aaaatttgaggcagttacttttgaatacaaaaagctctcagaaaagtttcaaatttttaa
aaaccaaacacttttgttatacagaaactctaaggttgattttttttttaactcacctga

Exon 15 +      35372      35509   0   Internal    138    96   Excellent
gttctaaataactcattttaggagttggtaatctaactgatgcttcttatgacttgagta
cttcatacacatttccttagtttcctttcactttttaaaaattacagattcctttaatat
ctctgatctattatgagttgtctccttttactaattttgtatctaattttgtcttttcag
GTGAGGTATATCTGTTCAGCTCTGGGTTGTCGCCAATGGGATAGTGACGAAATGGAACAA
GAGGAAGACATCCTGCTTCTACAGCGTACCCAAAAAACTGTTAGAGCTGTCGGACCTCGC
AGTGGCAATGAGAAGTGT
gtattcagataatgttgctgttggtattatttagaaatacacctaataccaaaatttatc
agatttctgtttgtggagattttgactattttgttgccttaaaagcatatatatatatat
ttttttgatacggagtcttgctctgtcgcccaggcttgagtacagtggcgtgatattggc

Exon 16 +      37656      38127   2   Terminal    472    59    Marginal
tagctgttgtaagggacacatcaagtcagtccacaaccctcaaaaccattgtgtctgaag
ggtcaggacaaagttcttgtgggccctcttgtggcataaatcagtagagcactcttttcc
agaaggttatgttgttagttttctcatcacataattttagtatttgcttcttcaatctag
AAGAGTTCTATATTATTTTGTCCCTTTCTTTAAATGTAAATTTCTAAAACACACCTTTGT
AAATTTAAGGTGGAATTTCAGTGTTGGCCACTTTGAACTTCGGTATATTCCAGACATGGA
AACGAGAGCCGGATTTATTGAAAGCACCTTTAAGCCCAATGAGAACACAGAAGAGTCTAA
AATTATTTCAGATGTGGAAGAACAGGAAGCTGCCATAATGGACATAGTGATAAAGGTTTC
GGTTGCTGACTGGAAAGTTATGGCATTCAGTAAGAAGGGAGGACATCTGGAATGGGAGTA
CCAGGTACCTAACACCACTGAGGATTTAAAATACGGTTCTTCCTCTCCCAGTCTGACCAA
ACTTATTGATTGGGTGGAACGAAATTACTACTACTTGGGGCTCTCAGCTTGTTCTCTGTG
CTTTTATAAATTTGTGATTTTAAATGGTATTTTATGGGTTGGAACTATATAA
ctactgcttgaattatttaagaccttttttccatttttgtttagttttgtactccaattg
catctgcctggttacttaaggatgggaaagtcattcccatcagtctttttgatgatacaa
gttatacatctaatgatgatgttttagaagatgaagaagacattgtagaagctgccagag

Exon 17 +      38172      38342   0   Terminal    171    94   Excellent
ttcttcctctcccagtctgaccaaacttattgattgggtggaacgaaattactactactt
ggggctctcagcttgttctctgtgcttttataaatttgtgattttaaatggtattttatg
ggttggaactatataactactgcttgaattatttaagaccttttttccatttttgtttag
TTTTGTACTCCAATTGCATCTGCCTGGTTACTTAAGGATGGGAAAGTCATTCCCATCAGT
CTTTTTGATGATACAAGTTATACATCTAATGATGATGTTTTAGAAGATGAAGAAGACATT
GTAGAAGCTGCCAGAGGAGCCACAGAAAACAGTGTTTACTTGGGTGAGTAA
atgtatcttatctaacgatagtacacattgacatctagattttcttcttacattgttcct
tcctacttcaggagtgcctgtagtagttttaaatcctaatatcatctctgatgtacgttg
cccttgagatttatacttcgatttccattcctgctacttttccatttgtccaattctgaa

Exon 18 +      39878      40016   0    Initial    139    49    Marginal
ctccctgtttttgttgaataaacattgagtttatctttgagtgcttcaagcatgtttctt
ctttgacaagagttttgtggtgtatgtagaaataactggaattaatgtaattttatttaa
ttaaaaaaacctttttaaaaaaatcaatgcataattgacaatgttctggttgattcagga
ATGTATAGAGGCCAGCTGTATCTGCAGTCATCAGTCAGAATTTCAGAAAAGTTTCCTTCA
AGTCCCAAGGCTTTGGAATCTGTCACTAATGAAAACGCAATTATTCCTTTACCAACAATC
AAATGGAAACCCTTAATTC
gtaagtgaattgtaaacttttctaaatactgttagtgttcagagacctaatcctgactgt
ctttgccctagttttgaatactgcagagataagaactgttatatactttatattttattg
ataaaccatgatggtatttcagatgttaataatgaatttttattttcatttagagcatca

Exon 19 +      40703      40799   1   Internal     97   100   Excellent
gagctctgggccatttgtttaacttatatgtttgaattgaattatggttgaatatcagtt
tattcaattaagcacgtgcatttttattcaagtcataacagttcagacttaagaaatatt
attattaagaaaataataattttcttttagattctccttccagaactcctgtcttggtag
GATCTGATGAATTTGACAAATGTCTCAGTAATGATAAGTTTTCTCATGAAGAATATAGTA
ATGGTGCACTTTCAATCTTGCAGTATCCATATGGTAA
gtgaaaatactgagttttatttattttattttttaatttgaaattaatagaattcaaatg
aagaaaagtcgattagagtatagacaataaaacatcttgggagacaatttcatgaatgat
tactaagcatacaagctccaaagttaggttgccagggttcagatcccatttttgccacat

Exon 20 +      42700      42936   0    Initial    237    80        Good
ggataaaggaaaatgtctatatttacgggagaaaaatgagacaaattaagatgtttaaaa
tacgttaaagaagagagacaaaacttaaaaggaattaatgtgataagtcacaggaaaatg
gataaattttaatagttaaagacgggcctatttttgattacctttaaaaaaaacgtttta
ATGTTTCTATTTGAAGATAATGGTTATTATCTACCATACTACAAGAGGGAGAGGAACAAA
CGAAGCACACAGATTACAGTCAGATTCCTCGACAACCCACATTACAACAAGAATATCCGC
AAAAAGGATCCTGTTCTTCTTTTACACTGGTGGAAAGAAATAGTTGCAACGATTTTGTTT
TGTATCATAGCAACAACGTTTATTGTGCGCAGGCTTTTCCATCCTCATCCTCACAGG
gtaagaatcatggttgcttactgtctggtttccacttccccacctcctatttgcttctca
acccatcacagtctggcttccatccctactgctccaccaaagctactcttgccaaagttc
tcagtgatcttccttgtgttaaatgtaatggacatttttcagtccttatctaactgaacc

Exon 21 +      50838      51054   0    Initial    217    52    Marginal
cttttgagtagtttaaatattcatatgtgccaggcactacataagtgataaaaactgagc
aaggtttctgccctcaagaagcctgtacctttttggtgcttctgtatgtacactcaagta
aatacaatgcaagaaagattttgacctttgccttatcttagtaaatattaatagcttctc
ATGAAGAAGAGCAGATGTGGCCAAAAGGCAGTCAAGGAAGTCAAGCTTCTTAGAAATGGC
GGCATTTGCTCTGGGTGCTCAAGAGTAGCCTTTCCCTCAGTAGGAGACAGGTGGGGAGGG
ATGGCCAAGTGCATGAAATGGCCCGAGCAAAGGCTCTCACAAGCACTTGGAGGTGGTATG
GAGAATGGTGAGAGTTCTGGAGTAGATGGAACAAAGG
gtaagaataggggaggatggaagagaggaagaaaaagataggttggccaggtacagtggc
tcacgcttgtaatcccagcactgtgggagtcctaggcgggtggatcatttgaggccagga
gttcgagaccagcctgaccaacatgacaaaatctcatctctactaaaaggcagttggagg

Exon 22 +      52074      52223   2   Internal    150   100   Excellent
aacagccttcagtgttgtcttactttctctctttttcaggctaattttatttctttaatt
ttccttttttattggtatataatacatctacatattttaggggtataagtcatataattt
gtaaagatcaaatcagtgtaattggaatatccatcaccttaaatattttctctctttcag
GGAATTGGCTCGGGAAAAGGTAATGCGAGAAGTTAAAGCCTTAGCCAAGCTTGAACACCC
GGGCATTGTTAGATATTTCAATGCCTGGCTCGAAGCACCACCAGAGAAGTGGCAAGAAAA
GATGGATGAAATTTGGCTGAAAGATGAAAG
gtaactaactttgttacacatacacttaagctagttttttgcttgtgtgattacaatgtc
agttttataactttagggatttttttttttaaagaaaaggaacagcagagttctgttgtt
tcatgttttgaaaagttctctagccacttgtgaaattttggtttagattttgagaacata

Exon 23 +      53331      53679   2   Internal    349    61    Marginal
tgaatggaatgtgatgttctgtatctcacattgcatgtttttatttagtttgtatgttgt
tttgttgtcatttggtaagtggccttattacagttgaagctttttaaacagagggtgcag
ttcaggtacttgaatcaatatatattcactcttacccctttgtatttctcccacttttag
CACAGACTGGCCACTCAGCTCTCCTAGCCCAATGGATGCACCATCAGTTAAAATACGCAG
AATGGATCCTTTCGCTACAAAAGAACATATTGAAATCATAGCTCCTTCACCACAAAGAAG
CAGGTCTTTTTCAGTAGGGATTTCCTGTGACCAGACAAGTTCATCTGAGAGCCAGTTCTC
ACCACTGGAATTCTCAGGAATGGACCATGAGGACATCAGTGAGTCAGTGGATGCAGCATA
CAACCTCCAGGACAGTTGCCTTACAGACTGTGATGTGGAAGATGGGACTATGGATGGCAA
TGATGAGGGGCACTCCTTTGAACTTTGTCCTTCTGAAGCTTCTCCTTAT
gtaaggtcaagggagagaacctcctcttcaatagtatttgaagattctggctgtgataat
gcttccagtaaagaagagccgaaaactaatcgattgcatattggcaaccattgtgctaat
aaactaactgctttcaagcccaccagtagcaaatcttcttctgaagctacattgtctatt

Exon 24 +      57736      57903   0   Internal    168    94   Excellent
gcagtacttgtctggcacagaaaaattgtcactattttcctgttagcccattttaaaaag
aaatatgcttgaaaatatctagtttgttgtattttttctttgtagtcttttaaataattc
tctttactttttcgcctccatgcacacccactgtacttttgtctgttgtattctttccag
CCATCCAACATATTCTTTACAATGGATGATGTGGTCAAGGTTGGAGACTTTGGGTTAGTG
ACTGCAATGGACCAGGATGAGGAAGAGCAGACGGTTCTGACCCCAATGCCAGCTTATGCC
AGACACACAGGACAAGTAGGGACCAAACTGTATATGAGCCCAGAGCAG
gtgagtttttcagacctttacttactagcacagcagcagatgtacctgatgaatctcttc
tcatgttttcattaaaatacccagtaatctaaaacccagtaagtctgaaaattatgaaaa
ctggcagtagtgttccagtagtggaatagtgacacagctaagatgtagtttctacaacct

Exon 25 +      65347      65522   1   Terminal    176    79        Good
ctgccctagggtgggtaaaattagatggcatcattaagcaggagtaaacatttattgcca
agttgcttcttataaatttgtgtttatttatattctccaaatagtgtgtgagggtgtcct
tttcagttcccctataagatttgtttttgcacattttttttaacacttccaaaaccccag
GGATAAGAAGTGAGACAGGGTTCAGATTGCTACAGTCTCTTGGAAGGGAAGAGGGTGATG
CCACTGATGTGGTCACTGAAGCTTTCCATCTGCTCTTCTATAAGTACAGAGGCAGGCAGG
CTGCGCAGAAGGCCAGGGAGACAGATGCCAAGTACGGTTTAGAGGGGAAGTTGTGA
agggatcataaaccctggcaactgccctgtgaccacctctacttcccagttaagaagtac
tggtatggagcatttccaaagttcccttctttggcagtttctcaaatgtcatgttatatc
tctaaagaaattttcacaaataaaggggttcttctgagtcaccaaaaggtcaattttaat

Exon 26 +      70841      70948   0   Internal    108    63    Marginal
gtctctggatgcttttgtgcattgacggcagagctgagtagttgtatcagagacttgaaa
actcgaatatggctcaaaagcttaaaatatgtacagaaatattttgccagcactgatttt
aaaaactgtacagtgatcaaacctggccgttttatcacaaaacaatttttatattttcag
TACGTGATGGTTCAAGACATGCTCTCTCCATCCCCCATGGAACGACCTGAAGCTATAAAC
ATCATTGAAAATGCTGTATTTGAGGACTTGGACTTTCCAGGAAAAACA
gtgctcagacagaggtctcgctccttgagttcatcgggaacaaaacattcaagacagtcc
aacaactcccatagccctttgccaagcaattagccttaagttgtgctagcaaccctaata
ggtgatgcagataatagcctacttcttagaatatgcctgtccaaaattgcagacttgaaa

Exon 27 +      72470      72639   0    Initial    170    62    Marginal
cccctaaagggagagctctcagagaaaagggctgtggtgatgctagttgtattgataccg
aggtgtatctgacatgtgccacatcgaggcatgtggcaggctgggctgatggggcatgaa
ccagctagacacaatctagaaaggtcaaaatgcatagcatctccatattacaaacaaata
ATGTCTGCCACGCAAGGTTATGAGCAACTTGTACGCTGGAAAAACACTTCCCAGATCTTT
GTGGCTGACTGTATATCCAGACTCGCTCGCAGCAGTGCTGCTCAAACGACTTCCTTCCCC
AGCTTCTGCTTGGTTCCTGTCCAGCTCACCCCCGTCATCTTCATCTCTTG
gtcagcctgctttagttgctattccttttctcccttcctctttaccccagccaggggtga
aggtttgttgacttctggcagcacaccccattcagtcccccaaagatcctttgaccccca
ggacttccctaggagctagccatggcagacactactattaccattctacttaccgtcaaa

--------------------------------------------------------------------------------