--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (97299 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (21 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5043       5236   0    Initial    194    66    Marginal
tgttatttctcaaatgctggatgcccaagggtggcaaacacactgtttggaccccaggaa
ggagcagacacatgtgggtgaagctggaggtcctgcttccttgcccagatcctcttgccc
agacacactctggaaatgcccatcattttatacacctacgtacacatgtaaccagccagg
ATGCCTTTGTTTTCCATTTCCGAGAAAACAGAGGACTATGGAAAACAGGTGGGCCGTAAG
GAGCCCTACAGAGGAAGATGCACCTGTGGCGGTAGCCCTGCCTGCACCACCCTGCGAGCT
CATGCCAGCTTAACTCACTTCACGGTCAATCAGACCTACTGCTCCAAACACAGTAGGAAG
GCGCGCCTTCACTT
gtgagtcggacgaaatcagcaatgagggcaataacaaccacagtcacgttactcttagta
acagccctgaggcccgcagtgtagcacagaagccaagcttagtggtgggcttaaggctga
tgttgttaactgataccattcaatagctagatataggcaactaaaaggtgagcccaaata

Exon  2 +       7349       7480   0    Initial    132    65    Marginal
ctctgtgtccttgggtaataaacattacctctggccccaaaaaatcctaatccttaaaaa
tatggaaatgcactgagcatccctaaaaggtactttagaggagtctcaaggttcattttc
tttaagatttagtccttaataaagactcaaaatggctgttcctaaagcctcctgtccata
ATGAAGAAGATAAATCAGAGTGTACACTTTGGGGATGTGTTTGTTGACATGCGGCATCCT
CTGCAGAAAGCCTGTATCTCCAAGAAGCGTGGCCAAGGGAGGGCACTGACAGCTGAGTTT
AGAGTGGGATTT
gtaagcagcacaaactaattgtgcatcggtagatttgcagagtgtggttttctgttgatg
gatttctttatgggcaataaaatctccaataagtaccatttacattcagcagaactcttt
ttgaattttagctcattcttagagagatttggagagagagagaccatccctgcacatgca

Exon  3 +      11265      11383   0    Initial    119    56    Marginal
gtgtgtgtgtgtgtgtgtgtgagagagagagagacagagacagagagagagaaagagaga
gagagacagcaaccaaagcttgggatggggcttggaccaggctgggggaagtggtggggc
agggggcagcccagggtcagccccagcaaacaagagtgttggaggagtgaggttcgccaa
ATGGAAGAGGCAAATCTGACTAAACTTCTCCAACCAGATGACACCTTTAATTCTGCATGT
CTGGGCTCTAAGACGCAGATTCTCCTTTTACCCAACAGCAAGAAAGAGCTGTTCCTTAA
gtaagggtcaagtactcgggcagtggatggagaaacacagtgagaggaggggcagccttg
gcatcctcagatgtttccacgtttccgaattttcagtgaatctggttttccacaacactg
aatgtttttgaagctggcacctctctgcttactgagtagatgcctaattggaaatggaat

Exon  4 +      12344      12388   0   Terminal     45    64    Marginal
caagtttgatatttttgtttttttactgagctttttgtacttaataggagacctggccac
ctaataagatggtgattattggaaaccacagagatgtaatcagatgttctagacatggat
ggtgtatttaaccccttgaaacacttccacgccctgcctggatccttttctgcttcatag
ACCAATGATGAGTTCCTAAAAGATATGCACGTCTATCCCCAGTGA
aggccgtagctcagcaggccctgtacttggcattacaggggcgggacctgtgtagccttg
ccctctggggccctttgctggtcttcctaccctgggctcttccctatgtcagtgccattt
gtcgggagaaggaagaacgactttgaaccgcagccctgttctgtggatgaagttggctgg

Exon  5 +      22276      22372   0    Initial     97    40        Poor
catcctggttagaactgctggggacaaacctccccataatgaacagaaaatgctacatcc
ctggtttgcaaaacttcaacagtcaaaaggatgcatgtacaattatttttctatagggat
gcataatccaaaaaacaaaaaaaggcttgaagacctatgagctaaaccattccatcttaa
ATGTTGAAGTATGTCTGGGTCAGCTCTGATTTAGTAGATCTAGGGGGCTCCAGGTTCTTC
ATTTCCAACAGGCTCTCTGGCGATGCTGATGCAGCTG
gtatgtggaccccactttgagaagagacagtttccactaaagtgagaacaatgacggcgc
cttccccaggtggtggctgtgaaaatcaggtgatattatccctgtgcagcactcagctcc
atcccagggcctgggactgaggcattcttgggacagtgggcgcatgtcctatgctcaata

Exon  6 +      32174      32285   2   Terminal    112    54    Marginal
tcccaccgtccttctgccctctctactgtgcgtcctgggtccagggtcttgccatgcccc
cctgttctgccccctgcctgaacaaacgcacccttgtgagccttctgcctcagctcctgg
aaggcactgccctggggttttttttgttttttgttttttgttttttttttcctgctgaag
GAATAACTATTTCATGGTTATTAATGAAAGTGATAGCAATTCCCTGTGTATTTATCTTAG
ATTATGTGGTCGTTACGAGCTGAAGTACCTCAAGCAGCCAGTCTGCGGTTGA
tttgaaaacaggcgagtctcaacagtgagcttaaggaaaggtgtcaggtataaatcttgt
cttcaaacagccagggtgcattccagacttcagagacacttctttgtataaaggcccttt
ttttctctcccgcctttctttctcctgggcctggaggaggatgaaagtgcaggggtgtgt

Exon  7 +      44434      44463   0   Internal     30    66    Marginal
tgttgtcccaggtgctactcccgtcactgtcacccgtaggtactgacatgagtttggggt
gtatctgaagagcctgtgataaagtcgggggaggctgagtatacccagtcatgccctggt
gcattttgtacctgacagctcctcacagctgctgggacacactccgagcacatctcacag
GGTGTGGACGACTGCCAGGAGGAGGGGCTG
gtgtgtccttggagtcaccagaaacttggcagccctccctaatgtcagattccttcatgt
ctgaggactagtgctgccagtactagtgcagagaatggagtcagaaaatgcaatcaagtc
attagtttgcttgaactgtcttttattttgaggaagggtcaaatggaagcataggataga

Exon  8 +      50247      50362   0   Internal    116    80        Good
ccacgcactgagattcccactactccctgggctcatagtggcttcaaaggggcagctgag
gtggggagtgggaggcaagggctgcagagtaggaggcacgtgggccggctcggccatgga
ggagccacacgtgctttgccagcccccatacgtcctccctccctgcaccttccccttcag
ACCATCCGAGCCATCCTGGGAGGCTCAGCCTCCACCACCCATGTGGGCACCTTCTGCATT
ACCTACAATAGCCAGCCTGAGAGGAGCAGCAAGCCCTCTGCAGGCCCTCGGGACAC
gtaataatggcagtcatctttaccgcctcttcacgtcattgcctgcggcagctctgtgct
attttagactctattgatcctggtgccaataaatggttcatattcttcaacttccttaac
ttagaggctatcgtctcagtcaaattgatgtcttctgtctggctgacatagcttgggatt

Exon  9 +      54154      54261   0    Initial    108    52    Marginal
gtactgaatcctgctgggtgtggggaggaggccaccagcagcctccccttgggtcttcct
ggaggaaggagagcgtgggaggccggggaaggagagtagcgctgggtgggcagggagccc
gcagccagctctgtggctgcctcccagacacaggcagttgccagcaccttgcctcccgcc
ATGGAAGAGCTTGTGCCCATGGAGCTGAGTGGGCCAGCCACAGCCTCTCCCCTCCCTGTC
CGTGATGCGGTCAACCCAGGCGTGGCAAGCCCTGCTGGGCCAGGCCAG
gtaagcacgctggaggggccacagacaaaagggacatccgtcctacagactttaaaaggt
aactccgaaccatcaggcctgccaaggcttcccacagccacctggcctcagctgcttccc
acagatatgaggtgtggccctttcagggagaagcttttggaagaggtagcaccgtcacag

Exon 10 +      55073      55169   0    Initial     97    63    Marginal
tgtctagtgcagagtctgcgtgtgtgtgtgtgtgaaaaggggtgctaatgacggcatttg
ttctttggaagaaggccagaacttaaagagggagagacccagccaaggctttcttcctgg
gctcccagaaggaattaaacattaattaaacattaaacattctctccccacctcagcaag
ATGTTGCTAGGAGATCGTCTAGACCAGTGCTTCTCAAACTTTAATGTGCACACAGACCAC
CTGCAGATCTGGTTGAAAAGCAGATCCCAGACAGCAG
gtctgggcggggctgagattctgcatttctaatgagctcccagctgatgctaatgctgct
ggtccaggggccccactttgagcaacaaagtggcaatggtgaggattaagccatggtagt
gcctggctggggtctgagctcagtagtcataagctgatgtgattacagctgtgtcatcat

Exon 11 +      59559      59609   0    Initial     51    67    Marginal
atgggtacagcttcagcttcatgtctgcttttcttttaggatgtatagtttcccctctgt
ttgctggaaggcaccttatatccagtggggttaaataaaggtagccagacccccggctgg
ggtgctaccgccagtgcccagctaatgacgcatgtctttcaggtgagcccttgggagagg
ATGGCCCATGTGGGGGACTGCACGCAGACGCCCTGGCTCCCCGTCCTGGTG
gtaagtggtctgagccccttacccccacagcaccctcatcctcatgatggttggactgtt
tcttggcctcttcagctgtaaaatgggaatgctgatcatagtccctcctccacagggttc
ttctgagggtgaaatgaaaccaggcctgcaaagcacagaactctgccccaggctgaagtt

Exon 12 +      60331      60453   0   Internal    123    84        Good
caggagccactggagacttagcagcagtgagcactcacaagcgggcaccttcccagaccg
agcccccagcagagcccccaccgcagggcacccccttcctatgtcaaccttggggtcttg
caggagtcacatgtgtttctaaggaggtacggaggccacaacacccccctttgttggcag
GTGTCTCTGATGTGCTCAGCCCGAGCGGAATACTCAAACTGCGGTGAGAACGAGTACTAC
AACCAGACTACGGGGCTGTGCCAGGAGTGCCCCCCGTGTGGGCCGGGAGAGGAGCCCTAC
CTG
gtaaggacccagccctcctggagcctggtgcgctctcaggggaggcctcctgcttgtggc
attgttgccctgagcctgccttgctgtgtgaggggatgccagggtatatcaaaccagccg
gtcacgctccctggacgttgagattgatggcaagagctgccgtgagcccaggaatggcac

Exon 13 +      61194      61375   0   Internal    182    99   Excellent
agcccagagcatgagctggttcctggggggttttgcagttaggacaactcaggaaaccaa
ggcccggcaagagtagcttctggagacagctggcacgtcactgcccaaggactgtgggcc
gagtccgtatggtttggctgctgcactcacctgtgtcccctgtcctctttccctggacag
TCCTGTGGCTACGGCACCAAAGACGAGGACTACGGCTGCGTCCCCTGCCCGGCGGAGAAG
TTTTCCAAAGGAGGCTACCAGATATGCAGGCGTCACAAAGACTGTGAGGGCTTCTTCCGG
GCCACCGTGCTGACACCAGGGGACATGGAGAATGACGCTGAGTGTGGCCCTTGCCTCCCT
GG
gtaagcacaggccctcctggcaaaccctggcatgctttctgcagaaaaccccgaggggct
acgggcaaggaccttgggaacaggggtcatggatactgcaggcctcggtgcagccgcaca
cctggccttggtcccatcccacaaggagcagcatccaggacggagagtcctggcccctcc

Exon 14 +      67120      67205   2   Internal     86   100   Excellent
ttcaagacaggctgaaaccccaaggaaactgagtggacagagcaggtgactgagtgggcg
tggcctcatgcccgacttgattgtgggcctgcagactggccaccgtgctctctgcaccag
tccctgcctgtgtgctgtccagctcacctgtctctgttttgtcttgtctctcccccgtag
CTACTACATGCTGGAGAACAGACCGAGGAACATCTATGGCATGGTCTGCTACTCCTGCCT
CCTGGCACCCCCCAACACCAAGGAAT
gtgagtgtctttgtccttccaccagcacggtatttgttcagcacggatccctttcactac
agagggtgtaggaaagagccggtcctggcacctggacaaggtgaatcacagtaacagcac
tagtgaaagtgctcctgtggcctgtccaggcaggtctatgaagggagggatgtttgccac

Exon 15 +      78320      78353   2   Terminal     34    69    Marginal
atagcggcaggtggacagcacaggcagctgcaagcccggccaggaggagagaccaggcgt
cctgggctttggtttggccgggagttaacagcaattctatcactggttttcatataaaca
tgctgaccatagcactttaatattaacttgcagaatgtacatttcattctccctaaccag
GGAAGAAGGGATTGAGGAGGACCCCAAAGTTTAA
tatgtctctcagagtcagccctccagctggcttggcctttctctctcactggtttagtgc
cagcccattattgaagcatgtttcgggcccaggtctcagcgagccgtgaggtaccctcca
gagccctcagagcacccagctcgtcagcttcatctctgggcctcccacgcgctaacgcag

Exon 16 +      79545      79626   0    Initial     82   100   Excellent
gcaagcacctcagatttcagggttccctgaaagcatcccaggggcagggccattgcttcc
aggggccggagtcctggagggaagaccagcagggatcctgagctctgggtcattcatgcc
ttctctccacccacagaactctcaggccaaggacacctggccactgccctgatcattgca
ATGTCCACCATCTTCATCATGGCCATCGCCATCGTCCTCATCATCATGTTCTACATCCTG
AAGACAAAGCCCTCTGCCCCAG
gtgacggcccccatgcgccggtgccctgcttcctggactctccgtcaactccccctgtcg
gagagcctggctgctcactccctcctctctccccagcctgttgcaccagccacccgggga
agagcgtggaggcccaagtgagcaaggacgaggagaagaaagaggccccaggtctgtgaa

Exon 17 +      79723      79797   1   Internal     75    80        Good
caatgtccaccatcttcatcatggccatcgccatcgtcctcatcatcatgttctacatcc
tgaagacaaagccctctgccccaggtgacggcccccatgcgccggtgccctgcttcctgg
actctccgtcaactccccctgtcggagagcctggctgctcactccctcctctctccccag
CCTGTTGCACCAGCCACCCGGGGAAGAGCGTGGAGGCCCAAGTGAGCAAGGACGAGGAGA
AGAAAGAGGCCCCAG
gtctgtgaaccagggcttccacacaccatgtgcacggtgcccatctctgggtggagggcg
ttcccagaagcagcctcctcgctgcttctgctctcacatgctgaaccatactgtgcttac
cgtggggtggtgccacacagacaccgggcagctctgcccaacaggaagagcagggttggg

Exon 18 +      80041      80113   1   Internal     73   100   Excellent
ccagaagcagcctcctcgctgcttctgctctcacatgctgaaccatactgtgcttaccgt
ggggtggtgccacacagacaccgggcagctctgcccaacaggaagagcagggttgggctg
agcgcagagccatgagccaattctaactcctatctccccaacctccccatttccctgcag
ACAACGTGGTGATGTTCTCCGAGAAGGATGAATTTGAGAAGCTGACAGCAACTCCAGCAA
AGCCCACCAAGAG
gtatgtggaagcccccagcaccaagctgaagctggggtcctgtggatcctgagcagggag
gggaaccagggtgcagccgagtgaactgacaggctagcctgggacactatggggacgttc
ggcgacagacagtccccaccacctctttgctgactggcaggggtcaggtggtgtgaggag

Exon 19 +      82554      82728   2   Internal    175   100   Excellent
gtatgtctcgtctcatgtcccctggtcccgtgcccacaaggtgcccagtaaacacctgaa
aaacaagtcattgccccccactgtccacagctgggcaatggacaagttcaccacaggaga
acttgtcagggctgcagcccccccaggcactgctaatgaccatcgctcttgtttttgcag
CGAGAACGATGCCTCATCCGAGAATGAGCAGCTGCTGAGCCGGAGCGTCGACAGTGATGA
GGAGCCCGCCCCTGACAAGCAGGGCTCCCCGGAGCTGTGCCTGCTGTCGCTGGTTCACCT
GGCCAGGGAGAAGTCTGCCACCAGCAACAAGTCAGCCGGGGTGAGGCTCCTGCAG
gtgccatgatgagctgtgagatgtggctccctcacagccgcaagactaaaactttcttat
tgaatcagctctcctgcaagacggggtgtttctcccagaagtccaagataggagacctgg
acagtgacaagttcacagcaagatagtcaaaagggaaaaaaaccctttcgtttttgagtt

Exon 20 +      84205      84265   0   Internal     61    93   Excellent
ggaaaacctgaagaaggccctcctccctgtgtgtcagggctgggctgctgacacgggggc
tgtgtgcagcgtctctggtgttgggcgtagctgctgcctgcccctgctgacatggaggat
ttgcctcctttctactgttgcccctttctggagatgaaaattctcgactctttttcacag
ATTCAAAGCCGGAGGAAAAAGATCCTCGATGTGTATGCCAACGTGTGTGGAGTCGTGGAA
G
gtaagctgaaaaaaaagcctgggagaggtggtgcccaccccaccgacatgaagggctggg
cccggagccctgaggctcctgtgaggggaactgagggaagccgcccatccagttgccgca
ctttggtcagaatggccgctggaaactatttcaggtgtggggaaacagaatcttgttccc

Exon 21 +      93344      93666   1   Terminal    323    99   Excellent
cagcgttctaggtgtcgtttgccttaagttatgcatttgttttaggtggctttctgcatg
ttttataattttaaaaaaatttttttcaaataatttttatttcatttaaataatttttca
gtgttgaccttctattgactgtgacttgcaacatctaactgtggccattggtgtctgtag
GTCTTAGCCCCACGGAGCTGCCATTTGATTGCCTCGAGAAGACTAGCCGAATGCTCAGCT
CCACGTACAACTCTGAGAAGGCTGTTGTGAAAACGTGGCGCCACCTCGCCGAGAGCTTCG
GCCTGAAGAGGGATGAGATTGGGGGCATGACAGACGGCATGCAACTCTTTGACCGCATCA
GCACGGCAGGCTACAGCATCCCTGAGCTACTCACAAAACTGGTGCAGATTGAGCGGCTGG
ATGCTGTGGAGTCCTTGTGTGCAGACATACTGGAGTGGGCGGGGGTTGTGCCACCTGCCT
CCCAGCCACATGCTGCATCCTGA
aaagcatgcctgtgggctgtcctcccaggacaagccaaggagccaacgagggctctggag
ctgtgagtggtgccaaaagactgccaagaatcaaggcttttgtgatatgtcaccgtatgc
cttaggatgttcaaggagccagacgaaataaggcctgtcttccaatttaaccaaagataa

--------------------------------------------------------------------------------