--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9924 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1659       1723   0    Initial     65    54    Marginal
agggagcctagtcaccggccgcaagcagagcccggtgtgctccgcttccaactgggagcg
ccttccgccacccggggagggggactgctgcagccacagggtggggctcttggttctttc
cgcctgactccttctcttctgcagccccaaggaggcccgcctgacgactgaccagttgcc
ATGGCATCCTACTACGAGATCCTAGACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAG
AAGGC
gtaagtgcctccgtatgcaacagaagacctctcaccctccacccgccaccaccatggggc
acttcagagtgacacctgtaggtgtctgagggaaccaggtcgttagaaagcactggggtg
cttcttccgagtgacacctgcagggaggaaagagacccctggtagagtacaaggagaacg

Exon  2 +       2403       2512   2   Internal    110   100   Excellent
gagagagggtggaacttgatgaaaatatcacagcagcggcagccctagcagctggggtgg
actgggacccgggggtgaaaggacagtgataggctaatgggaaaacaggtcgttcggttc
ctgggtgggaagtgcctgcatttgtcccccgactctctcctctgcacccactttctgcag
GTATCGGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAGTTTGC
TGAGAAGAAATTTAAGGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACA
gtaagggccggggtcaggcaggacccagcacatcaccccctacttcatgccccagctcac
attttcttaaagcaatgtctctgccacctagtttcctctgtgcctttttccagcctgaca
tttaagctcccccctcccacagggacagctcagtgtctgctccccagagtctggtaggag

Exon  3 +       2953       3111   0    Initial    159    44    Marginal
gtgggtgtcatctccatgagttctcacagccgtcctatgaggcaggttctatcaccccta
ttttacaggcaaggaaactgaggctgagagaggtgaagtaacttgctcaaggccacgcag
agctggaatatgaatccaggtctgcctttttattgattcattcgaaaagtaattcagtga
ATGGTGACAGTGTCCGGCACTCGCTGGGTGCTGGGGAAACTGGAGGACAAGCAGGCACTG
TCTTTGCCCAGAGGGGCAGGGAAGACCAACACCTACCAGGCACACACACAGACACAGTTA
CAGCTTGTGAAGAGTATTCCGAGGGAAGAAACAGGGCAG
gtggagtgctagggaataatgtgcacttgctttagttctggtggttgtagaaggcctctc
cgagaaggtgacatttaggctaagccctggtgaataataatgtagtaatcattagctaac
atttattgaacactttctatgtgtcaggcactggtaggcagtttacgtggatggtctcat

Exon  4 +       3543       3596   1   Internal     54   100   Excellent
tgtgtgaaaggctgagttgctgcctaaacctatagcccgtgtcccctgggtcccctgctg
tgcctgctttcccccgccaagtgtcagagtgtcagtctctggacaatcctttgaacgtcc
tagcctgggaggggagcccatcccagagggagggtgaaatgatctggtctctttttgcag
AGCACAAGCGGGAGATTTACGACCGCTATGGCCGGGAAGGGCTGACAGGGACAG
gtaggtggagtggtgaggcccaggaatggaggtggggcagggaggagaggggcagggcag
attcttgcaatggaggctctctcaggctcctggctgtgccttaggtgaggtcccccgctc
agggcaggatgcatgccctaagctctctcctcatcctgcctttccaggaactggcccatc

Exon  5 +       3764       3965   1   Internal    202    74        Good
ctgacagggacaggtaggtggagtggtgaggcccaggaatggaggtggggcagggaggag
aggggcagggcagattcttgcaatggaggctctctcaggctcctggctgtgccttaggtg
aggtcccccgctcagggcaggatgcatgccctaagctctctcctcatcctgcctttccag
GAACTGGCCCATCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTCACCTTCACCTTCC
GCAGCCCCGAGGAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAGCTCT
TTGGTGAGTGGACTCTGGAAGCCTCTGAATGGCTCAACTTCCCCCTCCAGGCCTGTCCTT
CCATCAGCTGGGAGGCCCTGAG
gtggaaggctgagaggggacgggaatgccacggacagaagattttgtggagctgggtcca
gtgagagccgggacagaacctcacgtgtgccagaacccccgtaatccaacagtgacactt
cacagactcaccttattaaattacaacaataatacattgttagacttctatagtaacagc

Exon  6 +       5244       5314   2   Internal     71    96   Excellent
agagctccttctggggccatagaggggtgagaggtctgctggggagctgtgttcaaatag
aaagttggctccttgagggcagggcccagtctgcgctctctactgcggtggccagaactg
ggaccagcgcctgcaggattctgtcactgctcgttgcctgaactgtgctgtctcccacag
AATCATGGAGAACGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTGAAGTCAGT
CACAATCAATG
gtgaggagcagctcccctacccagcccctggcaggaagccccagccccaacctcagcagc
ctcctccccaaactgctgctctctgaactcacttagggcttgggagggagtggcaacagg
ccagactggtaggatcagagatggcaatgtcgggaagggggtgaaggagtctcacgaagc

Exon  7 +       5411       5507   2   Internal     97    72        Good
ctgtctcccacagaatcatggagaacgggcaggagcgggtggaagtggaggaggatgggc
agctgaagtcagtcacaatcaatggtgaggagcagctcccctacccagcccctggcagga
agccccagccccaacctcagcagcctcctccccaaactgctgctctctgaactcacttag
GGCTTGGGAGGGAGTGGCAACAGGCCAGACTGGTAGGATCAGAGATGGCAATGTCGGGAA
GGGGGTGAAGGAGTCTCACGAAGCCATCGCCGTCACT
gtgagtggggtgccttacatttgcaaagcactttactatttttaaagcacttccagatat
acgatatcctctgtattcttcaagcatctgggggagtacacagggcagatggtatccact
tagttttaatttggggagcctgagctgcagcatagttaaatgaccctaacttccaagtag

Exon  8 +       6424       6812   1   Terminal    389    88        Good
ggatgttgagtgacttgcctaagggtaggagcttctacctggtagagctgaatacttcct
tgtgctcaaaatcacaagcctaggtgccaaaatgcatgtgtgccaattccaaataagaga
ctctaagtggtcagggttgttactgtgtgaggcagcctggcagtaatacccctggctcag
GTTGGGGCCTCATGGTGGCTGTGACTCTTGCAGGTGTCCCAGATGACCTGGCACTGGGCT
TGGAGCTGAGCCGTCGCGAGCAGCAGCCGTCAGTCACTTCCAGGTCTGGGGGCACTCAGG
TCCAGCAGACCCCTGCCTCATGCCCCTTGGACAGCGACCTCTCTGAGGATGAGGACCTGC
AGCTGGCCATGGCCTACAGCCTGTCAGAGATGGAGGCAGCTGGGAAGAAACCCGCAGGTG
GGCGGGAGGCACAGCACCGACGGCAGGGGCGGCCCAAGGCCCAGCACCAAGATCCAGGCT
TGGGGGGGACCCAGGAGGGTGCGAGGGGTGAAGCAACCAAACGCAGTCCATCCCCAGAGG
AGAAGGCCTCTCGCTGCCTCATCCTCTGA
acaccgggcccaacctgatctgatccagatcttgactggggggtctgactcactgtggga
agagaagaggggagtatcctgagttgtaggaactgctttccaactccaagctccctccac
aagtttccctcccaggccccccacaccccagtgtggacttgggatttgctgtgctcagcc

Exon  9 +       8834       8898   0   Internal     65    54    Marginal
aaaaccagctgggctgagctcagatccagggggaaatgctggaagtcaataaaactgagt
tttgagagcttggtggtgtgttgtgttcttgggttcctactttccggggtggcccaggag
ggcctctaagggacagtgggtgacacctcaggcctcacacctccctttatgcccctacag
CTAGAGGTGCAGGCCTTGCCAGTTGAAGGCAGAAATGCCCTCTTTGACCAGGCTGCCCTC
CCCAG
gtatgttatggaaccccaagcaatgcttcattctttgctttcacctcttgggggcctaca
actggctttccctagcagccgatgttccccttatgagtggcctcaccccctagtactcca
cagcacagctaggaccatactcaagttaagacttaactgaggctgggcgcggtggctcac

--------------------------------------------------------------------------------