--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22082 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        608        690   0    Initial     83    55    Marginal
gtgctccgaacatgtgaggtccaggctgcaaggatgtgcctggccctgcccacctgtgta
atggcgaatagggaaaggagggggcgacatggagattttgcagggaggagagagattatt
tcctagggggtctggccaggactgaagatttggaattgtgttttggggccatatttctga
ATGTTGGCTGTCATTCTCCTGTTGGGCTACCTGGCCTATCTTAAGAGGGTAGAGCGGGGT
AAAGTCACTGTTCTGCCAGTGAA
gtaagcccagtgcagaaaagacaggcgtccctaggcccaagggaactagatccataccat
actcagtggagccataggtcagaccccaggccaaccttgttggctgtgtaggggcaggga
ccctggtcttttggtttctagcccatgatagatgggccagtgaatgaaagcagtgtggta

Exon  2 +       1492       1539   0    Initial     48    45    Marginal
ctcctctggctcagtgtgagattgaaatccaggccctactcacatgaatttggaccctga
gtccagagtttagagaggggagggagagagaagagcaccagaaaggtagatgagagaccc
ttattttggctgtgtggaggctctaggcagctgatcgctttgaagtgtcacttgatgctt
ATGGGCCTGCTGAGGCCTTACATCCTGGGGGAGAGGGGAACAGTGATG
gtgagtgggtacagactaggaggacgtgtcaagactgcttccagccctaggacagtgtat
tcaagagttgagtgctgagggtctgtggcgtatgcccagcccttagtttctggcccacgt
gaagcaggggggcactaggacccagaggctagcacggttcctgacaagtctagagcagca

Exon  3 +       2001       2033   0    Initial     33    87        Good
ctgcccccacccctacccgtgtaggccaccgagtgaggcccatggactggggagggctgt
gcctgacgactcctgtgtccctctatgagggcccagcgccctgaccctcctgcctaggtt
tctaccttttctctctgtctttggccagctgggggagggggtagaggccgggtgagcaac
ATGGCACAGAGCAAGAGGCACGTGTACAGCCGG
gtaagtggccctaatctgggatggccctggagggctgctggggaaggcctggctgcctgt
ggacatcattgctgtgggggctggggagataggctggagctcagctgagggcactcagac
tgtgttttctaaggagccctcgaagccctggtggtgtaaggctggacaggcttcccttta

Exon  4 +       3793       4038   0   Internal    246    72        Good
atatcattggcattttttcaaaggggaatttgggggtccacccaattctgtaaatggggt
ttaagaaaatgactctggttgtttttcagtccagcatcttggctgaggcatttcttatac
ataagaatgccacctttgatctgaggcctctaactgtctgtgtttacctgtgtctttcag
ACGCCCAGCGGCAGCAGGATGAGTGCGGAGGCAAGCGCCCGGCCTCTGCGGGTGGGCTCC
CGTGTAGAGGTGATTGGAAAAGGCCACCGAGGCACTGTGGCCTATGTTGGAGCCACACTG
TTTGCCACTGGCAAATGGGTAGGCGTGATTCTGGATGAAGCAAAGGGCAAAAATGATGGA
ACTGTTCAAGGCAGGAAGTACTTCACTTGTGATGAAGGGCATGGCATCTTTGTGCGCCAG
TCCCAG
gtattcacgcccttcttttgtgtctgtgcatgtgtgcacatgtctgtcgcatgtgcagct
gatgtgttggtacttcgttttcctgagcatgggcataagcctctggttgggagagtggaa
ggtagtgggggagggaagattgaagatgcatccttagggaagctgccctgtactcttggt

Exon  5 +       4572       4606   1   Internal     35    56    Marginal
taacaaccacccacttaaagttgcctccccatagccaggaggagtccccaggacttctcc
tcataacatggggccacagtagatcctaagatttttttccgtcactaccatattccctta
ttatatctccccctacctctctatacaagtacacactttgtttctgtttgctttctacag
AGGGAACTGATACAACTGCAAAGACTAGCAAACTG
gtgagtgatttgggggtgggaatggggaataataaagggaggggaaggagaaagaggagg
gatacccagtgctaggcaggtagaagtagtaggtgagtctgatttgccttctagtctctc
caacttccctaagaaggaggctttctggggattaattgctgtgttagagttacagtaaag

Exon  6 +      10862      11059   0   Internal    198    97   Excellent
ccatactttccccatatatactgtgctacggtttcctctcagatgttcttatgccactga
ctgttggccaccctggggctgggtgatgtttgcacactttcttgtgttctttgcgccagc
tcagtgttggtggagaggaggagtgggctgtgcacagaccgtgaggcctctcctttgcag
GAGGAGGAGGGACTAAGGGCTCAGGTGCGGGACCTGGAGGAGAAACTAGAGACCCTGAGA
CTGAAACGGGCAGAAGACAAAGCAAAGCTAAAAGAGCTGGAGAAACACAAAATCCAGCTG
GAGCAGGTGCAGGAATGGAAGAGCAAAATGCAGGAGCAGCAGGCCGACCTGCAGCGGCGC
CTCAAGGAGGCGAGAAAG
gtttgactctggatgaagggggtggctggggcagcctgagacctaaggaagcatgctgga
aactagactggagctggagcctggaacatactgtgagaaaggcctggggcatctctgtgc
tggtaccccctcccacctccacttcttcctcaggaagccaaggaggcgctggaggcaaag

Exon  7 +      11213      11417   0   Internal    205   100   Excellent
cagcggcgcctcaaggaggcgagaaaggtttgactctggatgaagggggtggctggggca
gcctgagacctaaggaagcatgctggaaactagactggagctggagcctggaacatactg
tgagaaaggcctggggcatctctgtgctggtaccccctcccacctccacttcttcctcag
GAAGCCAAGGAGGCGCTGGAGGCAAAGGAACGCTATATGGAGGAGATGGCTGATACTGCT
GATGCCATTGAGATGGCCACTTTGGACAAGGAGATGGCTGAAGAGCGGGCTGAGTCCCTG
CAGCAGGAGGTGGAGGCACTGAAGGAGCGGGTGGACGAGCTCACTACTGACTTAGAGATC
CTCAAGGCTGAGATTGAAGAGAAGG
gtaaggggcccacagctgctgggggccaaacggtcaggtgagaaccatgcctgaaagtgt
taatgatcttctccaggctcagatggcgctgcatccagttatcagctcaagcagcttgag
gagcagaatgcccgcctgaaggatgccctggtgaggtagggtcttcagtgcttgcctctg

Exon  8 +      11494      11572   1   Internal     79   100   Excellent
agagcgggctgagtccctgcagcaggaggtggaggcactgaaggagcgggtggacgagct
cactactgacttagagatcctcaaggctgagattgaagagaagggtaaggggcccacagc
tgctgggggccaaacggtcaggtgagaaccatgcctgaaagtgttaatgatcttctccag
GCTCAGATGGCGCTGCATCCAGTTATCAGCTCAAGCAGCTTGAGGAGCAGAATGCCCGCC
TGAAGGATGCCCTGGTGAG
gtagggtcttcagtgcttgcctctgatgcttactcttgtgtctccaaatgtgttagagca
cccatcgccagagactctgacacgtgctttcctccttctgccttcctcacatccctgcag
gatgcgggatctttcttcctcagagaagcaggagcatgtgaagctccagaagctcatgga

Exon  9 +      11693      11852   2   Internal    160   100   Excellent
cagttatcagctcaagcagcttgaggagcagaatgcccgcctgaaggatgccctggtgag
gtagggtcttcagtgcttgcctctgatgcttactcttgtgtctccaaatgtgttagagca
cccatcgccagagactctgacacgtgctttcctccttctgccttcctcacatccctgcag
GATGCGGGATCTTTCTTCCTCAGAGAAGCAGGAGCATGTGAAGCTCCAGAAGCTCATGGA
AAAGAAGAACCAAGAGCTGGAAGTTGTGAGGCAACAGCGGGAGCGTCTGCAGGAGGAGCT
AAGCCAGGCAGAGAGCACCATTGATGAGCTCAAGGAGCAG
gtctggggagcccagcccctcacccagaatcccccacctgactctcctatcagttgatgc
ctcctctttctaggtaccttccagcagcccttctccctatcctccccgtaacacaggtgg
atgctgctctgggtgctgaggagatggtggagatgctgacagatcggaacctgaatctgg

Exon 10 +      11969      12073   0   Internal    105   100   Excellent
gcgggagcgtctgcaggaggagctaagccaggcagagagcaccattgatgagctcaagga
gcaggtctggggagcccagcccctcacccagaatcccccacctgactctcctatcagttg
atgcctcctctttctaggtaccttccagcagcccttctccctatcctccccgtaacacag
GTGGATGCTGCTCTGGGTGCTGAGGAGATGGTGGAGATGCTGACAGATCGGAACCTGAAT
CTGGAAGAGAAAGTGCGCGAGTTGAGGGAGACTGTGGGAGACTTG
gtaagagaagagcagacccctgacatctgacttggacctgctgagaaaaagattgacatg
tgacccttggcctttgagcagggtgtgcggtgagggacccagcctgggcttgctaccctg
accctgccttttttttttttttttttttctgagatggaatctcgctctgttgccaggctg

Exon 11 +      12547      12738   0   Internal    192    96   Excellent
ccagctaatttttgtatttttagtagagatggggtttcaccatgttggccagcatgatct
cgatctcgacctcatgatccgcctgctttgacctcccaaagtgctgggattacaggtgtg
aaccaccgccgctggccgaccctgcctttctttagcccaaactatggtgtggtgtcctag
GAAGCGATGAATGAGATGAACGATGAGCTGCAGGAGAATGCACGTGAGACAGAACTGGAG
CTGCGGGAGCAGCTGGACATGGCAGGCGCGCGGGTTCGTGAGGCCCAGAAGCGTGTGGAG
GCAGCCCAGGAGACGGTTGCAGACTACCAGCAGACCATCAAGAAGTACCGCCAGCTGACC
GCCCATCTACAG
gtacatgcccactgtttgctctctgcccaccatcaccccagggcttccttatgacccagc
tgtgcttcactgtctctcctcctaggatgtgaatcgggaactgacaaaccagcaggaagc
atctgtggagaggcaacagcagccacctccagagacctttgacttcaaaatcaagtttgc

Exon 12 +      12824      12949   0   Internal    126   100   Excellent
gtgaggcccagaagcgtgtggaggcagcccaggagacggttgcagactaccagcagacca
tcaagaagtaccgccagctgaccgcccatctacaggtacatgcccactgtttgctctctg
cccaccatcaccccagggcttccttatgacccagctgtgcttcactgtctctcctcctag
GATGTGAATCGGGAACTGACAAACCAGCAGGAAGCATCTGTGGAGAGGCAACAGCAGCCA
CCTCCAGAGACCTTTGACTTCAAAATCAAGTTTGCTGAGACTAAGGCCCATGCCAAGGTC
AGGAAA
gtgtgtgggtctgagggagccctgcctgggatgaactggtatggggtctgggcttcagat
tcctgggggaaggggtgctttgtgtggtggtttggaagactctggcctgggcttgcccta
gaagcaagggatctactggagcaaggcatgggaattttggggctctttcagctctggcta

Exon 13 +      13158      13310   0   Internal    153    86        Good
ggatgaactggtatggggtctgggcttcagattcctgggggaaggggtgctttgtgtggt
ggtttggaagactctggcctgggcttgccctagaagcaagggatctactggagcaaggca
tgggaattttggggctctttcagctctggctaagagtcctcctccctgttcacctcacag
GCAATTGAGATGGAATTGAGGCAGATGGAGGTGGCCCAGGCCAATCGACACATGTCCCTG
CTGACAGCCTTCATGCCTGACAGCTTCCTTCGGCCAGGTGGGGACCATGACTGCGTTCTG
GTGCTGTTGCTCATGCCTCGTCTCATTTGCAAG
gtatggccaatcaatcacatgttccacagaaatctagtgaacttgccatgaaccaggcat
tgaagatgctgagtgaagacaacagagtctctgcccacaaagagtttatggtatagtgga
ggaacacagcaaagtcaccgattaatatatattacaaatggtgtgttttcaaggagagat

Exon 14 +      13907      14067   0   Internal    161   100   Excellent
gtaatcacatcactaccctttccccatgcaagattccccacccaggtaagagctatttct
gctttctctcccatgtgtgtccatgctccccacatagttaagctctgagtactatattcc
tgagtctctgttctccatcctctgctctgaggcccaggttcctggtgctttttcccacag
GCAGAGCTGATCCGGAAGCAGGCCCAGGAGAAGTTTGAACTAAGTGAGAACTGTTCAGAG
CGGCCTGGGCTGCGAGGAGCTGCTGGGGAGCAACTCAGCTTTGCTGCTGGACTGGTGTAC
TCGCTGAGCCTGCTGCAGGCCACGCTACACCGCTATGAGCA
gtaagtgactcctgactccctcaccccagggtgggggtccaggattggccagaactgaga
ttgcctggcagactctagcctcacagtgcccttctctggtctctagtgccctctctcagt
gcagtgtggatgtgtataagaaagtgggcagcctgtaccctgagatgagtgcccatgagc

Exon 15 +      14192      14342   2   Internal    151    99   Excellent
gctggactggtgtactcgctgagcctgctgcaggccacgctacaccgctatgagcagtaa
gtgactcctgactccctcaccccagggtgggggtccaggattggccagaactgagattgc
ctggcagactctagcctcacagtgcccttctctggtctctagtgccctctctcagtgcag
TGTGGATGTGTATAAGAAAGTGGGCAGCCTGTACCCTGAGATGAGTGCCCATGAGCGCTC
CTTGGATTTCCTCATTGAACTGCTGCACAAGGATCAGCTGGATGAGACTGTCAATGTGGA
GCCTCTCACCAAGGCCATCAAGTACTATCAG
gtgtggggcaagaatttgggcttggggcaggaggcagggaagctttcacttgatgggggc
tcttactaatatattcaaggttgtatgtcccatgcttgctgcttgaggcctggtttgctc
ttagatgaactctccatatgatgcagctgcttgagggctttggattctcttgtacctcca

Exon 16 +      14618      14703   0   Internal     86    88        Good
ttgctgcttgaggcctggtttgctcttagatgaactctccatatgatgcagctgcttgag
ggctttggattctcttgtacctccagagacccatgatgaccagggctcaaactacagttt
gggaagaactccccacccgctccagggcctaaaagttgtctgtctgttatctctcctcag
CATCTGTACAGCATCCACCTTGCCGAACAGCCTGAGGACTGTACTATGCAGCTGGCTGAC
CACATTAAGGTGAAGTATCTGGGCCA
gtgattgagcccccgtggagatcagaaatggagggcatcaggtcaagagatcaggcaccc
aagaagtgtcacataagactagggcagagttaccaaagccatatcagggaaactagagga
cctacttatgtatgggggtcagcagaggatggggacttcttagagatgttgataaggcag

Exon 17 +      15106      15261   0   Terminal    156    84        Good
cacagttcacgcagagtgctctggactgcatgagtgtggaggtaggacggctgcgtgcct
tcttgcaggtgagaacacatctagatctgtgtgagctcctcttctttcttagtcctcact
tccttactccgagccttaatgctaacttggttctccatccattttctttttcctgagtag
GGTGGGCAGGAGGCTACAGATATTGCCCTCCTGCTCCGGGATCTGGAAACTTCATGCAGT
GACATCCGCCAGTTCTGCAAGAAGATCCGAAGGCGAATGCCAGGGACAGATGCTCCTGGG
ATCCCAGCTGCACTGGCCTTTGGACCACAGGTTTAA
ggctgcaactggggaagggaaggaaactgagtagaaacatgaagggtatagcacttgaag
atctggatctggttaggggacaaaaatggttttggggtagctggaaactgtggtgctgaa
cccagggttgactcctgactctggcctggcacacaggtatctgacacgctcctagactgc

Exon 18 +      15444      15579   2   Internal    136    97   Excellent
ctgcaactggggaagggaaggaaactgagtagaaacatgaagggtatagcacttgaagat
ctggatctggttaggggacaaaaatggttttggggtagctggaaactgtggtgctgaacc
cagggttgactcctgactctggcctggcacacaggtatctgacacgctcctagactgcag
GAAACACTTGACGTGGGTCGTGGCTGTGCTGCAGGAGGTGGCAGCTGCTGCTGCCCAGCT
CATTGCCCCACTGGCAGAGAATGAGGGGCTACTTGTGGCTGCTCTGGAGGAACTGGCTTT
CAAAGCAAGCGAGCAG
gtgggcctggatggctgggtagaaggtgtggggagagttagtgaccagtgtggggctttt
acttctgcccttggctcctgcagatctatgggaccccctccagcagcccctatgagtgtc
tgcgccagtcatgcaacatcctcatcagtaccatgaacaagctggccacagccatgcagg

Exon 19 +      15663      15794   0   Internal    132   100   Excellent
ggcagctgctgctgcccagctcattgccccactggcagagaatgaggggctacttgtggc
tgctctggaggaactggctttcaaagcaagcgagcaggtgggcctggatggctgggtaga
aggtgtggggagagttagtgaccagtgtggggcttttacttctgcccttggctcctgcag
ATCTATGGGACCCCCTCCAGCAGCCCCTATGAGTGTCTGCGCCAGTCATGCAACATCCTC
ATCAGTACCATGAACAAGCTGGCCACAGCCATGCAGGAGGGGGAGTATGATGCAGAGCGG
CCCCCCAGCAAG
gtaggtggagatttccttggagaagttgcagaggcctgtaggagtaagacttgcagagct
actgctagttgtgggaggacggggagacaggaggaaggcatctggagagcaccatcctgc
ctagaaggcagggttttccctgtaactggatctctctgtaaggagcacagtgatgatctc

Exon 20 +      16020      16145   0   Internal    126    88        Good
aagacttgcagagctactgctagttgtgggaggacggggagacaggaggaaggcatctgg
agagcaccatcctgcctagaaggcagggttttccctgtaactggatctctctgtaaggag
cacagtgatgatctcttctctccaccctcactttctcaccccctaccgaccattccttag
CCTCCACCGGTTGAACTGCGGGCTGCTGCCCTTCGTGCAGAGATCACAGATGCTGAAGGC
CTGGGTTTGAAGCTCGAAGATCGAGAGACAGTTATTAAGGAGTTGAAGAAGTCACTCAAG
ATTAAG
gtgagggtagtgtaggctcaggatctgggggccaggaaattggtaggactcaggaaagca
gtgagtgttggggatcgggaccaagacggcttgggagttaaggggagaagtggggcctgc
aatcaatgggagctgtggtgagccctcagggaacctactatctcatggtctagcccccag

Exon 21 +      16381      16523   0   Internal    143    96   Excellent
aagcagtgagtgttggggatcgggaccaagacggcttgggagttaaggggagaagtgggg
cctgcaatcaatgggagctgtggtgagccctcagggaacctactatctcatggtctagcc
cccagtttccagggactgtggggaggatgtcagggatctagaagttctgtccttgtccag
GGAGAGGAGCTAAGTGAGGCCAATGTGCGGCTGAGCCTCCTGGAGAAGAAGTTGGACAGT
GCTGCCAAGGATGCAGATGAGCGCATCGAGAAAGTCCAGACTCGGCTGGAGGAGACCCAG
GCACTGCTGCGAAAGAAGGAGAA
gtcaggcactttccctggggccttgcttcctctaatcctcccactgctggagctctctgc
ctcctaacccatacccctactcaggttctcttatagtgagactccccattttctttaccc
actgccaaccccattgcatcaccccagcctaagcctgtgctgctctgccctggcttctca

Exon 22 +      16797      16963   2   Internal    167    87        Good
tagtgagactccccattttctttacccactgccaaccccattgcatcaccccagcctaag
cctgtgctgctctgccctggcttctcactggcagggctattccaaggacctctcaggact
gaatagtcaaggagtgctttagagaagggacactgccaaagcccagattctctttcacag
AGAGTTTGAGGAGACAATGGATGCACTCCAGGCTGACATCGACCAGCTGGAGGCAGAGAA
GGCAGAACTAAAGCAGCGTCTGAACAGCCAGTCCAAACGCACGATTGAGGGACTCCGGGG
CCCTCCTCCTTCAGGCATTGCTACTCTGGTCTCTGGCATTGCTGGTG
gtgagtactgtggaataggcagcactagcacagaggagattgtcttctctcctgtccttg
gcctcattttgacctctgccccaccccccttacccccgggtattcagccaggaacatgct
tacacagtttcactctgtgccagttttcaccaagttttcccttccgctgaagatgtgtgc

Exon 23 +      18611      18744   1   Internal    134    83        Good
acccactctggccgggggttaccaggctggtgggagttggagctaagggagcagggtgga
gggggaagccaggactggagatgggtgatggggggatgaggaaaggggaagagtaggaat
ggagcccaattttcaaccctttccacttggggctgatgagattttttatggtccccacag
GAGCCATCCCTGGGCAGGCTCCAGGGTCTGTGCCAGGCCCAGGGCTGGTGAAGGACTCAC
CACTGCTGCTTCAGCAGATCTCTGCCATGAGGCTGCACATCTCCCAGCTCCAGCATGAGA
ACAGCATCCTCAAG
gtgagggagccacggggaggactgggatgggagatggagcatatttgccccattgatgat
agatgacaggggcctcctagcacctcttaccactatccttcttttttcatccacagggag
cccagatgaaggcatccttggcatccctgccccctctgcatgttgcaaagctatcccatg

Exon 24 +      18861      19044   0   Internal    184    57    Marginal
tcagcagatctctgccatgaggctgcacatctcccagctccagcatgagaacagcatcct
caaggtgagggagccacggggaggactgggatgggagatggagcatatttgccccattga
tgatagatgacaggggcctcctagcacctcttaccactatccttcttttttcatccacag
GGAGCCCAGATGAAGGCATCCTTGGCATCCCTGCCCCCTCTGCATGTTGCAAAGCTATCC
CATGAGGGCCCTGGCAGTGAGTTACCAGCTGGAGCGCTGTATCGTAAGACCAGCCAGCTG
CTGGAGACATTGAATCAATTGAGCACACACACGCACGTAGTAGACATCACTCGCACCAGC
CCTG
gtatgtacctgccaacccccaagatgaataaaactgccccctccacttggcccagggatt
tagcccctgctcaggtggttcccccaccacagaagctcttcccagcagtgttctttggct
tcactgttcagtttgtttgattcacccactctctctcaagtacttgttctgttagagagt

Exon 25 +      19309      19454   1   Internal    146    79        Good
caccacagaagctcttcccagcagtgttctttggcttcactgttcagtttgtttgattca
cccactctctctcaagtacttgttctgttagagagtcttatacctgcacccctaaccctt
aatccagtagaactgcctgcctgcgccttggtgggcctcaccagctttctctccccacag
CTGCCAAGAGCCCGTCGGCCCAACTTATGGAGCAAGTGGCTCAGCTTAAGTCCCTGAGTG
ACACCGTCGAGAAGCTCAAGGTCAGCTCAGTTTGCCAGGCAGAGCTCACTTCACAGCATA
AACTGGTGGAGCCAGGCACTTGTGGA
gttcctctgagcccagccctgtgctagacagcaattggggaggagatggaagggaaggca
gggttcttgccttggaagctcactgtctcagtgcaaacagaagacagattctcataacaa
aatggataagctagggtaatctttagagtgactggttcaggctttagcttccatcagcgc

Exon 26 +      19897      19986   0   Internal     90   100   Excellent
tgcaaagtaaggaggagtgctggtgtggggatggggttggagatgagagcaaaagtatgt
tgatatagaggactaagtccctgcccccctggtattagtgtctctgtgaaaccacgtggt
cttgtgctagcctgtgggggtcccataaatgaacccttgtcttcctctccccttccctag
GATGAGGTCCTCAAGGAGACAGTATCTCAGCGCCCTGGAGCCACAGTACCCACTGACTTT
GCCACCTTCCCTTCATCAGCCTTCCTCAGG
gtgagggggagcatggggtggaggatgggacagtgtggagagctcaggcgggcccccctc
tcctccagaattggaggaggcctttggagtctcaggtctaacaactgcataccttgggtt
atctggccaaattttacttacaagtaactcagaagtgcttacagtgctttgaaattccaa

Exon 27 +      20402      20539   0   Terminal    138    89        Good
tcccttgtcagattatgtatccccattcttatttgaaaaatgtggtcacaatagcccagg
atctcagaagccctagtcacccaggagctgccttggtctcagtgctcagggaccccttca
gtggcccacagctcaagtgagcccctgacctggagtctttttctcctcatcaaccaccag
GCCAAGGAGGAGCAGCAGGATGACACAGTCTACATGGGCAAAGTGACCTTCTCATGTGCG
GCTGGTTTTGGACAGCGACACCGGCTGGTGCTGACCCAGGAGCAGCTGCACCAGCTTCAC
AGTCGCCTCATCTCCTAA
gcactcctttcccctgctgtccccttcgaccctcagccctctggtgccgctctgcccgat
gcacagccacctcagccagcccccaggtagaaacgtgggttaagctcttcctgccccgtt
cagcttcactcccaccctttcagcgtcctgccccttcaccttgacccgggttcccccact

--------------------------------------------------------------------------------