--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (71296 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1551       1655   0    Initial    105    47    Marginal
ccggtaagaggagcaggaggaggaggcaggagccagagagagccggggggacggaggggg
gacggggaggcgccggacacccgcgcttggggccttcccctcgcaggaggggccgcggta
aagatggagcctccgcccgagccccacaacatcgccgccgctcgcagcgaacaaagaata
ATGGCGGCGGACTGGAGCCAGCGGCGGCCGGGGCGGCAGCGACTCTGCCTGCAGCCAGCG
GCGGCGCTCATGGCGGGGGGCGGCGGGCGGCGGGCGGCGGGCGGG
gtgggagccggcggccgggggtgtgtgcgggcggccggccgcggcgagctggcgcccgcg
ttcccgccgccgccgccgggccgggcgcggagccgggaacccggagccgccccgggggag
gccgcccgctcggcccggcgctgccccccgcgccgctcgctcgtccggcccccgccgccc

Exon  2 +       5841       5922   1   Internal     82    55    Marginal
agacagggtttcaccatgttggtcaggctggtcttgaatgcctgggattataggcgtgag
ccaccacgcccagctggtctgttactttttaaattatttattattactatatgtaataca
gtgggtcagaagctacaacaaatccaaagatgaattacgctgtcttatctctaccctcag
GAACTGTTGGGGACACAGTGACTAAGGCAAAATATGTGTCAAAAGAAAGCAGTCAAAGGA
AAAAGGGATCACCTTTGGTGAA
gtgaggagtatattttttatatttctaatttggttttttgaataagtaattcattcacat
gatctataattcaaaacataataacagcaaaatgccctacattctcttgccctattacct
aagtgttagcaattttttatttgtcctttaagaggtgttttatgcaaacacgagcaaata

Exon  3 +       9453       9547   1   Terminal     95    89        Good
aaatttttaataattttgtgcatgaaacagttttgactgtgaactgttacatgaggtcag
gtgtgggaatttttcatggcatcatgtcagtgctcaaaaagtttgagattttggatgttt
tattagggatgcttaccctgtattatattttgcccagatgtttcctcatttgtcttctag
GCTACCAGAAAGATGTTAGCTTAGAAAAACGTATTCTGGCGTTTATTCCAACAGATGAGA
AGGCAGTTTCTCCAGTGATGAATAATTACCTATAA
tttaatacgtgcattatacatctccagtgatgaaaaatcactgtgtattaaaaaattctt
gaagctaggtacataatctcaactcctaaaaaagaaaataaacagtagtactccttgatg
aacttacagatgctaagttgccttttcttagagttgaaataaggtgataaaggagtttac

Exon  4 +      14132      14197   0   Terminal     66    59    Marginal
gtgtatatcataaattcttgtttattataaacatttaaaaaatatctctgatctctgtga
aggcccaggcaaacaagataccattatttaatgaaaaataactgaagctactaatgtgta
tttggagttataatccacctacctcaggccttccctttattctgtgtccatatccttcag
TTTGTAGTGACAGATGAAAGAAGCAAAGATGAAAATCGAGAAATAATTTTGAGTGAAACA
TTTTAA
tttgaagcacagttgtcccttggtatcgatggggaattggttccaggaccccttcaggta
ccaaatccacggatgcttgagtcccttatataaagtggtatagtatttgcatgtaatcga
caaatatcctcccatatactttaaatcatctctagattacttataataccttatacagtg

Exon  5 +      17430      17540   0     Single    111    58    Marginal
aggcatgagccaccgcacctggccaaacatatttttctttaactgaggaaattagattca
ttgtccaaagcttaaaaggaagattttctactttgagtttttattaactctgatacttta
ctatgacagtacttccagcctctgagacatgagaaatagcgtgagattgtagtaatcaaa
ATGACCTTACCAGAAATCACCACCAGGTTGGTGAAAAACAGTACATCTACACAGAAGGAT
GGACTTGATGTTGATTCTTTCAAGATTAAAGATGAAGATGCCCGAACTTGA
agcaagtcttttatcaaaaccgtacataaagcaaaacacactgtatgatactgtaatggt
ggacacatatcattacgcatttatctgtagaatgtgcaacaccaagagtgaaccgtaaga
ttaaaaaagaaacaacaacaataggctgggcgcagtggctcatgctggtaatcccaacac

Exon  6 +      26875      26994   0     Single    120    58    Marginal
atttgaataagtttgatggtaattcagctacattatattttagctagatttctgagttca
tttggtaacctaaccaccacatatatacctatttataacttgaaatttgcctttaaagtc
acgaaagcacaaagcactgtggtgcttgtaacactcttccatattattataggtaactaa
ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCT
GAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATAA

aatacatggagagattccagtttgtgtctcttcctagaggaatacgtttccaagagaatt
tagttgttattacatagatatacatagaatgagcagagatactcttacaatatcaaaatt
cctatttacttagtattagagtatatttagaaatgatagtattaattcaataacagtaaa

Exon  7 +      31471      31611   0    Initial    141    89        Good
tttatagtgttttttcttaaagaatattaaatttagtcattactttcatatcagtgaaat
acatatctagcaaaaaggtcacgtttttgcttctaaaaagttatttcatattgaacatga
gtactgccaaagagtgtctgggatgataattcttttctgtgttcaacaccataggtatct
ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAAT
GGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT
CCACAAGTCCAAACAGTTCAG
gtatgtgtataaaaagttctgcatctattttaataacttttgtttatagccatatctctc
tcctttcactagttatgaaaataaggacacatctagttcagtttattttattcacagtat
aggaatatgctgcatctgtatagtcaccttatgtataggaacatatatacagaagaacaa

Exon  8 +      40429      40521   0   Internal     93    85        Good
tttccttgaacaaatgagcagatacatgtctgttttcatatttcccttttttccttacac
aaaagatatgctgtatccattatttggatgtaccatagttgattcaaccacttgccttta
tatgggcatatagattgtttccagtattttttttcctttttatttgtttttctattttag
ACCTTGGATATATGGCTCCAGTATTTTGCAGTTACAAACAGTGCCAATGGGAATAATCTT
AAGCGAGTTTATTTTAATATTGTTGGAATTGGG
gtgaattcctggaaatgggattgaggcacgaacacccatatttccttaaatatcaacaat
tccttatatcgggattgtgccagttttatactcccagcagcaatgtatgagagtgtggtg
ttttttgtttttgtttttgttttttttgtagctttgctaacagattttgttaacactttt

Exon  9 +      41418      41520   2   Internal    103   100   Excellent
gccactgcactccagcctggcgacagagcaagactccatctcaaaaaaaaaaaaaaaaaa
aaaaccttctgtcctaagcactagcagctttctgtgagttttctcatctttaactatatt
tgtatttagccagtaaattgtacttatatttttaattattctagttttctaattttgtag
GAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAA
GTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACG
gtgccaactccaatttaccaaactagcagtggacagtatagtgagtaatagacaatttct
gtttctattgtgaggagaaaaaagtgaggagaaaaagctaatagttgcattctcttcaga
gaaaccaatacaagtgccaagtcttctcagttttgctgccattattatatttcctttact

Exon 10 +      46525      46721   0   Internal    197   100   Excellent
gggtttcctgaggagcaagttacttgaatatattagacccttcttggtgatgttatttgc
tgtaacttctcctagattattttacaaattattctacattggatgtaatgttttaaaagt
cttatatggtattaaacttgtaacaataaaatccattggcttttagttgccattacccag
GGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTA
ACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACC
ACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGGTAAGGGAATT
CAGAATTCACAGGTGTG
gtaaattcttcaaaatactaaaattttataaactcacagaaaaagtaagtatcatattgc
aaaccaccattcaaatgtagttaacatttcttcaatattgatagtatttttcatgaactc
ttccattattccaattggaccaaaatgtcatggcataaaaacaactattttcagttttta

Exon 11 +      48314      48467   0    Initial    154    57    Marginal
agttagaaaaataaaacttcagtttatttagccattatcatttacattaaaacaatatgt
ttttcaaataatataattggcatcaagtgatacactttttcatacttttagttttgtttt
aattcaaaatttataatagttgaccataatgctttatcttctttttcattttgctatttt
ATGAAAAATCATGGTCGTTTTTATGTCGTGGCAAGAGTCTACTTGAAATTTTTTAATATG
AATTTACCAATATCAAAGGAAGACACTGAGGACTATACTCTATCTAGGAAGATCATCCAA
GCTGTGCCCCACTTACCTTTTAGACTTAAGGTTG
gtaagcatgttaacaacagaatagaactgcattcaaatgaaaaataaaatgtaagatcca
gcggacataggttactgtaataaatacattacattgggaattatttcttagtagtggcgc
gaagagtgctgattctttcaacgctttagccagaatcatcttttcttttttgtttccctt

Exon 12 +      68153      68297   2   Terminal    145    90   Excellent
gattaaaattttaatataaggtaatttccaagtaattctgtatatcttttccaatgctta
atatatactaaaatgttggttgctgtgagctatttctttaaaaaagaaaaaaaaaaggta
atccaaaataaatatgtggaaatcatttgcataatttttcccgtcctcttttgcttgtag
GGAAGCAGCTCGAGAGTGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAG
AGTGGCAGTGCTTGAAAATCAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGA
CCTTTACTGCCACAAATCAGATTAA
tttgggatttaaattttcacctgttaaggtggaaaatggactggcttggccacaacctga
aagacaaaataaacattttattttctaaacatttctttttttctatgcgcaaaactgcct
gaaagcaactacagaatttcattcatttgtgcttttgcattaaactgtgaatgttccaac

--------------------------------------------------------------------------------