--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (149647 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (43 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1414       1455   1   Internal     42    84        Good
gggtttgcagaggctgccctggggctggtgctgaaagaagagcccacagctgacttcatg
gtgctacaataacctcagaatctacttttcactctcaggagaacccacatgtctaatatt
tagacatgatggcaaactgggcggaagcaagacctctcctcattcttattgttttattag
GGCAATTTGTCTCAATAAAAGCCCAGGAAGAAGACGAGGATG
gtgagtttgccatttgctttgcttgtagtgtttattgcacggtttgggaaataggtggaa
tgttaagcctcaggaagagcgtgaagaggaggttctggtttgaagtttgagaagggggct
gacggatttgcacctggaaaacgacttgaaagacaattgggatgtttgtaaatccggagc

Exon  2 +       6540       6663   0   Internal    124    60    Marginal
tctccagttgactctgatttacattggtgaaccactgtattaaatctttgactgacactc
tgaatcttgttgtggacctgttggcttttatgttccgaggctacacattaagattttggt
aataacttgctattctagttattcattttacttataaggctgcttagttgaagtttgtag
GTAAACCATTGCAAAGTCACCATCACTTCTGGAAAAATAACTCAAGGCCCAAATACCCCT
CATGGTGGATTAGGCGAATCATTCTACTATGCAGAAGACACATGCCATTTGCATGTGTTT
CCAG
gtgaatgcatgtttttcattttcaatatttcctctctcttactttctgctcttcacactt
tgagcactatcgctacaggcctgaaattcattgtgttcatcattctagacaggtacctaa
tgcaggatgtgaggcaaaagcagaaagaggaagctttgttttaagaagctggaaattaga

Exon  3 +       6742       6827   1   Terminal     86    77        Good
tcacttctggaaaaataactcaaggcccaaatacccctcatggtggattaggcgaatcat
tctactatgcagaagacacatgccatttgcatgtgtttccaggtgaatgcatgtttttca
ttttcaatatttcctctctcttactttctgctcttcacactttgagcactatcgctacag
GCCTGAAATTCATTGTGTTCATCATTCTAGACAGGTACCTAATGCAGGATGTGAGGCAAA
AGCAGAAAGAGGAAGCTTTGTTTTAA
gaagctggaaattagaagattggaatcgtgttaatctatggccacagaatgtagttttta
aaaatcatacagttttctctggtttgaagaatgattaatgcatcatcacctggccttaca
tggcattcttaaaatgtatggacatggatcaactgatctttaatcggattttcttctctg

Exon  4 +       6965       7051   0    Initial     87    45    Marginal
gcaggatgtgaggcaaaagcagaaagaggaagctttgttttaagaagctggaaattagaa
gattggaatcgtgttaatctatggccacagaatgtagtttttaaaaatcatacagttttc
tctggtttgaagaatgattaatgcatcatcacctggccttacatggcattcttaaaatgt
ATGGACATGGATCAACTGATCTTTAATCGGATTTTCTTCTCTGAGATCACAACATTGAAA
AGCTTAGATTTATACATTAGAGATATA
gtaagggtgggggaaaagactggaagtgttgattattaattgatctattgtataaatttg
ggcaagttacacaagtttatataagacaaatcttggaattatataaagatattccttgat
ttaatattttttattatttatatccatgaaactataattttcactaaaaatgtagcacga

Exon  5 +      17750      17818   0   Terminal     69    88        Good
tgcatcatgtgttgtgttatgctgtttagccacagactcagtgttctctaaatgtttttg
gtgagaagggatgtcagagtttagcagcgtgccttcttgccctgatgctggcggattcat
ctttgcaatgcttattttttccaacaatccttgaacataccaaactgctatttcattcag
AATAAGAATAAGAATAATAATGAGGAAAAGAAGGAGAACAATGGGACAGGTGGAGAAGGA
GCAGAATAA
tggggcgagagagaaggtgaattattattattattattaaatggttgtgggcttttacct
gaggagtagatcatatttgttcttgattccttattttttgcctcttcttgacttcttatt
tttcttggcaatcatgtttgatgggagatacataagtgtttactatgaatatttagaaaa

Exon  6 +      19412      19510   2   Internal     99    60    Marginal
cccagaaagtcagatccagctccagtgctatgcatatagtagaaactcaataaaagtttg
tgactgatatttcaagcaaaatatattttcttcatgtttcaaaattaagtgctttttctc
tgttgttagattgctgtctaattacattgcacaaccttgcctaagtttttatatacatag
CATTGAGCTTAAAAACATGGAACCAGCTCTTATGCATAATTTAGCTATATTTAGCATCTT
TGGTCCAAAGCCTTATAAAAATATGTACATCAAAGCACT
gtaattaaatggaaacaaagttaaatttatattttacttgttttatttatagtgacttga
gtcagagtatagggacacaaagatgattgacatattatcttgtatttaaggaatacataa
tgagaggaatagatacattaacaaataactataatgctgtctaataaatacagtgagaaa

Exon  7 +      27090      27190   0    Initial    101    60    Marginal
ttgactcataaaatgtgtagttattaatatgactgaaagtgccagagtttgcagtcagta
ggttgcaattttccatagccagggaatattggaaagctgttattcaaaggcaatgcagaa
tcttagggggtctatacaggaactaccttttaaggaaaatgcgtcttaccagtgaaagtg
ATGGAGGATGATTTCCAGATGTTCAAATGCTTGTTTTGGCAACTGCTACAGAAAACTGAA
ACGTGTTGCCAGAACAACCAAAAGGGATGTGAAGCACTGAT
gtaagagggatcaggccatggaaagcaaggcaagcagaaaccagagagtatatagagaga
taccagagaggggagatagttgagccaagagaacaaactttagagccccagtaattacat
gtagtaaaagcatatctgcctctgtatgaggatgcacacccaagcttatcacccctgtgc

Exon  8 +      34835      34920   1   Internal     86    54    Marginal
tagtgtccctgtagcccatagaataagtaaggttcatattttttagtttaacaaccaatg
cctttcataatttgatccctaattattctatcttcattcacttcccactgaactttttct
tttcttttgcagtacaattcttactaaatggtaaaatttcacaactgtaccttctcccag
ATCTTTCTGGAATACCTTTCCCATTTCCTTCATTGTTCATCCGATCAATGTATGAAGATA
TCATCATTCTAATCAAGATGTTAGTT
gtaggtgccttttcagttaaattgcatgtaaccttcctaaatccttggtccttgccttca
atgtaattctactgtcttgctctttatgagtccagatgtgagagtcattacctcactcat
gtacatggcaaactccactcatgtcaagtttttggaaatttaataatttaactgaagatt

Exon  9 +      36133      36228   1   Internal     96    81        Good
gttctaaactctaagaagggctagttcagaaaggatcattggaacaagaggaaaattgca
tgctaatgtattccaggagatgatgaaatctctcatcttattaatttggcagtgttgagt
tcctcttctgtagaatgtaatttcctttctaaaagatatgaagcatctgttcccactcag
AACCAAATGGAGAATTCTTCATCTACATTAGCAAGTCAGGCCTGCTTAGTGCCCCAACTG
TGCTTACTGCTCAGGATGTTCTACTCACGCTGACTG
gttagtgcatctggtgtttcacattatttgttggaattataagcacttatcatcttccca
gttcattaggattaaaaaactctgataaaagtatatatataaaatatatgtattttttaa
ttcaagaagatggcaaatggattttttcagtcttgaaaaatatataaatataatatatac

Exon 10 +      62352      62466   2   Terminal    115    60    Marginal
aactgaatactaattcaagtcactagatatttccaagaggataaaattagaaattggcct
ttgggatgacagcactagtctcctttcacccatgcctccagaactgagctccagagggaa
taatgcagaaagaggcatccctttaaattcctattagaaattttcttcaaaatattttag
AATCCTTGGTACTGAAATGAATGGGATCAAAGAGCCATTGAGAACTGTGGAATGTTTGGT
GGATTGTAAAAGAAATTTCAACTTGCTCAAGGCAAGGGCAGAGAATAAAGAATGA
attggaagaaataagctgactacaatgtctggattttctctagaggccctaaatattctt
ctgtatcagggaaaattgaaaaaggaggcaaaatgcagctgcaaagacataataaaatac
agagttaaattgattctaaaatgttttatgtaaaatatttaattttatactcattgagta

Exon 11 +      64507      64636   0    Initial    130    44    Marginal
cagaagatgtaaaaccccataggcctaccccatacatacttatcctcccaccatcccata
gatcttgaggctgagatagaaaaaaattgtcaaagtatgtaatagatccccctcaggtat
ccctggtggcttcatatgtatctaacttttcaaatttgggagttgtttaaggaaagcaaa
ATGAGGAATGTGGAATTTTTGGCATCTCCTCTGCATGGTCTAAAGAAGGAATTGAATGCT
GTCCCTCTTCGTCTTTCCCTTCTAATGATAAACAGTGCCCTAGAGCAGAAGGAAGGGAAG
GATTTCCTTG
gtaggttctctggaaccccatccaggagcccacgctctgctgtgcattactaaaggcagc
atctgtggcatccagactgacacgtgggcggctttattacctcctcctttgtcccacaag
gcattctctctccacttcatgaggccaccagctgacagtgtcatgattatagtccctcaa

Exon 12 +      65136      65331   2   Terminal    196    48    Marginal
tgactgacacagtcttcttcctttctggtcacacagaggcctgaatgtcagggacacacc
tggtaagaaccaccaagtgaccattccctttcattcaaaaaagggttcctaagagcacat
cctctctggaaagattagggaaggaggaaagagagctaaaagtgcttatctttttaatag
GCATATCAATGAACTAGTTCCTTACTTTCCTCATTCACATCTGCATTCATCAATGCTACA
CATACGTTTATCAAAGACGGATTATATAACATTAAATGTGAAGGTTGCTGAGGTAAACAC
AGTTCTGGCTGTCGAGGAGCTCACAGTCTCACAGCTCACAGGGGAAAATGATCAGCACAA
ACCTGTGTCTGAATAA
gagatttaaaatttttataacacgtgtgtgctgtgtattatttctgcttgaaagaacttt
agttaatggctagagaatatctaacataattttagggacttttatttcatatatttttca
aagcctgtaagtagactccaataatttaatatgcaaatacagtcgtctctcttggccagt

Exon 13 +      70514      70698   1   Internal    185    97   Excellent
tatttcatggtgaattacatattattttgttatgaaatgaaatcagttcatctgtgtttg
gctccttggaaggttacttcttagtccagaattttttagaatccacaagatggctcacct
tttattttctcaattctataatttcagattactaacctcttctttcttttcttattttag
AAGGATATGGTGAAGAAATAGCCTGCACTCAGAATGGCCAGATGTACTTAAACAGGGACA
TTTGGAAACCTGCCCCTTGTCAGATCTGTGTCTGTGACAATGGAGCCATTCTCTGTGACA
AGATAGAATGCCAGGATGTGCTGGACTGTGCCGACCCTGTAACGCCCCCTGGGGAATGCT
GTCCT
gtctgttcacaaacacctggaggtggcaataccaattttggtaagaatgtttagggccaa
ctcataattgatccagttactcacctttatagttgcagtgtttttcactttcagcattca
gcaactcaagagaataattaagcagcttttttggtggcttttggggttaatgattaatga

Exon 14 +      79141      79240   0   Internal    100    85        Good
ttaaattttattatttttgtattttttaaaatagaaagactctagaagttagtggatgtg
aacatgcagaaataagcctattttactttgaagcccatatatgttgattctttcttgtcc
taggctttgtgtaggttggctattagtccctagtgtttcaatcttgaacttaccctatag
AACTGCCTCCTGCTTCTGGAGAGCCCTTTCCTTCTTTTGGATTCTCAATTTATTCCTTAC
TTCCAGAGTATTCGCTGCTTCAACATTAGAATCAGCAACT
gtgactgagttattattagttccgcccttaagtccatcatttcacttcatgaagttttgt
caggatagtattggaaggatataagtagattgtatctttagtagtacaatttggtgatat
gggttaaaaacttaaaatgtctttagtccacaaatttaacttctaaaaacatatcataag

Exon 15 +      88543      88648   2   Terminal    106    86        Good
agttcagacctatgctgaaatcagtagtgacatggctgatgaaattactctaagtggcta
gattgccatgtatttttaaaataataaacactcccttgccattaagaagtctgtgccttt
agctttctactaagtgtatatttggcagtgggttctaattttaactggcttgttttccag
GGCCCTCGTGGACCTCAGGGAATTGATGGAGAACCAGGTGTTCCTGGTCAACCTGGTGCT
CCAGGACCTCCTGGACATCCGTCCCACCCAGGACCCGATGGCTTGA
gcagggtgagttgtgtgcattgtttgatgtcacgtacaggtcatgttttaaattattgat
atattgttaggattttaaattgtgtctgttcagatattgacacttgactgtaagagcagt
taaataaggtcaacactgctatggacagtagaactaataaacccacagggaattgttgga

Exon 16 +      95191      95248   2   Terminal     58    66    Marginal
ttattctgattttacacattaggaaacagttacagacagattaagtaacttgcccaaagt
cacacagctggaagatggcagagccaactgtctaaacaattacactgtatattgacagag
tacagggtttaatattctatttttccttggtttgtatatatactttgttttcaactgtag
GGTGGTGCAGGACCTACAGGACCTCCTGGTGAACCTGGTGATCCTGGACCAATGGTAA
atgtcaagtaagcatgtagacccagttacatttgggtccaccattataatgatgtcaaat
attgagttatttatcttcccaggtcctccctaatgtaggaagaaataacaatccagtttg
ggagtcctgttctatgaactgttcttaagctatatgtttctcatagcagaatatttaaat

Exon 17 +      95750      95807   2   Terminal     58    45    Marginal
gatgcaacataaaattcaaaactttaataaaactattttctctgtctcaacaatatttat
cattttcatttgtttcaataatagtttgacatttcatttgtctcaataatgttttgaatt
gtattactggcaagtaaaggtaaatattctttttttccttttgttttgttctgttattag
GGTCCGATTGGTTCACGTGGACCAGAGGGCCCTCCTGGTAAACCTGGGGAAGATGTAA
gctacctttcctcattttccattcaggttttgaagaggcgaaggggttaaaatgttaaca
agaatgttctgtattaatttccattacatttccccacccttttagcttgcattaaattca
atgtaaacaggagcactcagaatggaattttacaaatatctaaaagggctcttaatttgc

Exon 18 +      99920      99962   2   Terminal     43    82        Good
tgctaattttgatcacccagatatattttgacagataaaagtatactgcttttttttgtt
cttcttaatatgttgctggaaaactgtgtactagctattttttgggaaaaaatgatatat
taaggaattttgcatccttattaatgactgtaaaatgccctatctatgttttcctcccag
GGAGCTCGTGGATTTCCTGGGGCTCCTGGTCTTCCAGGTCTGA
agggtcaccgagtaagttcaatctattgtaatcctctcagatactgtggtttagtgaaca
ggctctggggagatttaccttcaaaatctttacaagtcaatttgtcaattgtccttaact
gtctatggttgcagtattcatctgtggttactgaaatcacaattttttaatacatttcct

Exon 19 +     101856     101900   0   Internal     45    65    Marginal
aactacactactattgcattttgagaagaggtaataaaacaacattctgagatcctatat
caaaagtacatctttcatatgtcctctttgaaaatatgcttttaaaattacacacacaga
acaaagtgatgtatcggttgtaggcttctcatactgtaatgtattctcatttttttttag
GGTGAAGCTGGCCCCACTGGTCCAATGGGTGCCATGGGTCCTCTG
gtatgtgctcgttttcttgtttcttaaatttctaaggttatatttccttgccttttagat
tacaacaagagaatttttaaatgaaaaataaaaataaatggacaacatatgttggctagt
aaaataatcttgattaccagctgatagacaagcacaggagagttgagcccttctaacaga

Exon 20 +     105526     105570   2   Internal     45    65    Marginal
ctaccatatcagcttgtgtaaatgtatttatattgctattaactgagtgagggttattgt
cagttaactttaatatttattcttcaatttgcaatatggaaattttttataaggcaaata
agagaaaatatagtctaaaatgtaatcttatcctgtcttgtctctttttctcttaattag
GGACAACGAGGTGCACATGGTATGCCTGGAAAACCTGGACCAATG
gtgagttatattattttcatattaattcattaatttattcatgcattcttccatttgtac
attcaaaaacatttacagagcactcaccacatgccagacacttggaataaaaagttgatg
gacacatagtacttcttcaaaactgttctattaaggaagagagagatattaatattgttg

Exon 21 +     112693     112737   0   Internal     45    99   Excellent
tttacctattttatgtaaaggagaagtagtcaaaaaagtaatttttatgatataatggtg
gttgatttttaaaaaatgcttctacttcctttttgaagatggctggacatctgtatacta
gcacatttgtatctatatattgcttaatatttcattacatacttttaatgtaccttttag
GGTGCAATAGGAACTGATGGTACTCCTGGTGCCAAAGGCCCAACG
gtgagtactgcatttatggcatgtgaagctcaaatgggcatgattctttagacattggcc
ccagactgctacctgtgtctctacttaccacatcactcttgctgtttaatagggctctcc
aggtacctctggtcctcctggctcagcagggcctcctggatctccaggacctcagggtag

Exon 22 +     114181     114238   2   Terminal     58    58    Marginal
aaaaatttacacatattaacatattcacatgcattcatttaaaaatgattatattatact
actgatgcaaaaccgactcagctggagagaatttttaaagcctatttattgtaactaatt
tgagcagattggactagctaaatgtcctggttcttacaaatatcaatatatttttttcag
GGTGATCCAGGAGTTCCAGGTTTCAAAGGAGAAGCTGGCCCAAAAGGGGAACCAGTAA
ggtttcattgttttaatgataagtagaacatagtattgtctggaagtgtacagctcaaaa
tgctcaagggtttaaaataataatgagaattataatagcttgagatgaaaatatctcatt
gttccatatactttaaaatttgtgactgacttcgttaaattaggcttccaactataattc

Exon 23 +     115906     115959   2   Internal     54    59    Marginal
atattcttcaaaattttaaagtttttccatcgagtcagatttttctcatgcatatctata
gccatgttggcttgatgatggctcctaaaactttatagtgctaaaaataaaaatcaccta
ttcattacatattgcaaaaatatcaacaacaattaagaatcacattttggtcatttgtag
GGTGCTCCTGGCAATCGTGGTTTTCCAGGCTCTGATGGTTTACCTGGGCCAAAG
gtgaggttgccctgtcaatgttgatacttacgtggggggtgctccagaagatgccatttt
tcagcacggtgatctagctatggcctgcatgggctcagatccagaaaggagatggataca
aataccaggcctaaccccaatcctctcttgtgtaattcctgtattaagaggcataggggg

Exon 24 +     118045     118098   0   Internal     54    67    Marginal
gaaggaattatacaaaagtttcatttattctttagggtgaccctgggaaacctggagaag
caggaaatgctggagttcctgggcagagggtaaatatacattttctgctaaagaaaaata
atgtaggtactatttaaattatcatagactcacctcacaaatatctgtgtgtgatactag
GGAGCTCCTGGAAAAGATGGTGAAGTTGGTCCTTCTGGTCCTGTGGGCCCGCCG
gtatgtgatttttgtgtgtgtgtgtgtgagaatatatatatacacacattgcattttttc
gatgatgtttgttcaagacttatgggtaagtttcagggaaagtgaataagaatgtatggg
aatgaagaatttctgttataccttctcttttgatttctgtgagataatgtcttctgcctt

Exon 25 +     120199     120233   0   Internal     35    75        Good
tgcttctgaacaatattttttacttaaaatgtctgaacaatatattttcattgaaaatat
agtcttggagaccccatgaattgtaaaaggtaaactgttaacactggtagcctgttaaac
ttacacagattcacaattttattttcttacttttgttttaggggcttcctggtcctccag
GGCCTCCTGGAGAAGGTGGAAAACCAGGTGATCAA
gtaagtgtttaaataataataatggcaacactatacattgctggctcaattatcactttt
tatgtgtgaggctctgttgtgctttcctttacatacattatctctttgagttctcaaagc
agccctatgtactaggtactatcattatctccattttgtagatgaggaaaatggggcata

Exon 26 +     122436     122478   2   Terminal     43    69    Marginal
tgtgctatgaaactagcatatccttacttcaaatttatttcttatcactaaattagaaaa
ttgagatttagtaatgtctcatttctgaatttttccgcagtagaagccatttctcagaaa
cattttgacctatttttagatcaagtattgagattatttgacatcccaattttgtgctag
GGAGAACGAGGAAATCCTGGGGAAAGAGGAGAACCTGGGATAA
ctggactccctggtgagaagggaatggctggaggacatggtcctgatggcccaaaagtaa
gtgtcatagtgatctcagtgttttaaaatgctttaaaattactgcttaataaacgcatga
tggtgtgagaatgcatttgtcttgtttttgaaagataatttgattatatcattttcttct

Exon 27 +     123519     123643   0    Initial    125    90   Excellent
gcaatcaaaaacaaaatctggtttttttaatttcaaaatatcaactcactcagagacaac
tttctcagatgaaaaatataagcactaagttgaactacatgaaattgctgacaactactt
ttgacccactaaaaagcaatttcattagtttaatcttaatattattggtatggtcactta
ATGTTGGTTCATTTTAGGGCAGTCCAGGTCCATCTGGGACCCCTGGAGATACAGGCCCAC
CAGGTCTTCAAGGTATGCCGGGAGAAAGAGGAATTGCAGGAACTCCTGGCCCCAAGGGTG
ACAGA
gtaagtcctttttttttttttttttttttcagttcatttattcagactttctgctgaaaa
tgaaatgatttcttgagcaggcttttatttctaccatcctgagtcactagtcattcattt
ttcattcttctaataaacatttactgagaaaatgcacagtgtgaggcaccatcccaggct

Exon 28 +     123937     123990   0   Internal     54    96   Excellent
ttcatttttcattcttctaataaacatttactgagaaaatgcacagtgtgaggcaccatc
ccaggctcacctggatacgactaggaaaatgacaattagccttcactctcatgaaactta
cacacaagtgtgggaaagagacaattaaatgaatcaattgtattttgtgtgttttcccag
GGTGGCATAGGAGAAAAAGGTGCTGAAGGCACAGCTGGAAATGATGGTGCAAGA
gtaagtgaaagtattccttttctagctgggctaggaaccaacattacagtatcatatgag
tttccctgaaccttccaaaataaagtcagtcatgtttccttggtagtcaggagttggaga
ataatggcatgtgagatctgctgtgattcaaccacggtttattcattttgcttaccctga

Exon 29 +     126695     126804   0    Initial    110    93   Excellent
taggttgcatgaaagagattaaaacactgtgtggagaaaatatggtggaaatggtattaa
actagacagaaaactcttgaaaatatatagattatatcatttattatagataatgatttg
caaaggcagccaaattataacaaaatagtcgtttcttttttgtttgttgatttgctaagc
ATGAAGATTTCTGTGCATTTTTTACCTCAATATGCCTATGTTCTGTTAATTGACAGGGTC
TTCCAGGTCCTTTGGGCCCTCCAGGTCCGGCAGGTCCTACTGGAGAAAAG
gtaagtcacaagttgttaatttgtacactcaaaattatgagtcctgaatagcaggctctt
tcataaatcttttcattttataacatatggtatctgagcaagatcatttcagagttcttt
tccactatctcctcctacacagtgaccaatgtcctaaaattatgtttagctactgttttg

Exon 30 +     128738     128795   2   Terminal     58    80        Good
accagttaatctagattaattccccaaaatatgggattcgtacgaagaaaaaaaaatatt
gcttacaacatgaaaggaaatctaaaggcttcagtcttcctgtgaaaaaaaatcccagga
aaatacatgtaactaatttatattaccttaaaaattgcttatatgatattctggttctag
GGTGCTACAGGATTTCCTGGTTCTGCGGGCAGAGTTGGACCTCCAGGCCCTGCTGTAA
gtcaacttagtgagacaagtcactgataatgaaataattacacacacacgtatacatttg
agttaaatttattattttatttaatttcttaatggtatgttttcttatttaacaactctt
attccaataatgcatgctggtatttcagcaaagcaaatcatccttaataatctagtattt

Exon 31 +     129366     129403   1   Terminal     38    54    Marginal
ttggagtggagctttaaataagtttgaaaattcaagttagttgcaccactctttaaaaat
tattcaaagggaattgactgcaaatgatatttagttttccccctggggaatgaatctaca
gctgtgttttcttttgttttgttttgtttaaatcctatagaatgactgattatctaacag
GTAAAATGAACCTGCGAGGCTTGGACATCTGCATCTGA
ggcagacagcgttatgtcaatcactcttacttgccttccattttgccctccttggtgttt
ctttctttgttatactagggagctccaggacctgcgggacccctaggggaacccgggaag
gagggacctccaggtcttcgtggggaccctggctctcatgggcgtgtgggagatcgagga

Exon 32 +     129510     129643   0   Internal    134    96   Excellent
tgtttaaatcctatagaatgactgattatctaacaggtaaaatgaacctgcgaggcttgg
acatctgcatctgaggcagacagcgttatgtcaatcactcttacttgccttccattttgc
cctccttggtgtttctttctttgttatactagggagctccaggacctgcgggacccctag
GGGAACCCGGGAAGGAGGGACCTCCAGGTCTTCGTGGGGACCCTGGCTCTCATGGGCGTG
TGGGAGATCGAGGACCAGCTGGCCCCCCTGGTGGCCCAGGAGACAAAGGGGACCCAGGAG
AAGATGGGCAACCT
gtaagtttggcgtatccgttccagaccaccttcaactgagatatttacaaatagaaaccc
ataatgatcagtgtcacaaaaatgcttaaatattatgctgggcacattcctaaaattttt
aaagtgcattaaatctataaggctttaggaaaaacgtgtatatatatagattttaaaaat

Exon 33 +     130287     130394   2   Internal    108    90   Excellent
atgttagaggttctgtgcggattacaatttatgactactcatatgcagtatgattttgag
aaacagagaacttctttttcatactgaaaaacctgtaaagctgtacccaacttattgtaa
attccttgggtacagttttaccctggatagtttctgattttagtttgtcctcaacattag
GGTCCAGATGGCCCCCCTGGTCCAGCTGGAACGACCGGGCAGAGAGGAATTGTTGGCATG
CCTGGGCAACGTGGAGAGAGAGGCATGCCCGGCCTACCAGGCCCAGCG
gtgagtagctgcatcggtcaatattttatctcatatgtgcaatacaaattgtttagagaa
ttgattttattttttttgcttgatgaatagatttaaacagtattgtagggacattaattt
ttgagtctcttaaaaatcttttgatcttaaatgtcaaattcttaactaccttacaaagtc

Exon 34 +     132701     132754   0   Internal     54    93   Excellent
tacagtaattcaaaataatgaaaaagaggtagaaaccgttcttctgctgacatttgcata
aatgctaactgacagtttataaaacacaggtgtaaaacatgctgtcattttttgacaatt
ggaatgaggatttttttcattactcagttaagtagtttttcaaaccattattctttatag
GGTCCAGCTGGCAATGATGGTACCCCAGGACGGGATGGTGCTGTTGGAGAACGT
gtaagagccatttcacttattataaaatctaaagtcatgcaaatctgaaatctttttaat
ttacactaaaaactgtcatttttcctgatagttccaatacacttctgatttttctgaata
acaactgtttctgtaaagccataatttttatatcttgtaaatgaaatgatatttgaatat

Exon 35 +     133263     133396   0    Initial    134    49    Marginal
tgtaatgtctaaatttttccattcaccatctaaagtgaatgccgtatgagaatataagcc
atgtggctttttaaacactgtatattccatgatgtgttttaaattagaatgtgctgaact
gaacatgtccccaactttctctgaagccccagtcccttctggcagttgcacagtcatctc
ATGCTGCTGAGATGGGCCACTGAAGGCAAAATCACTCCCCACTCCAAAGTCTGTTATGAT
GTAATTAAAGCTCATCATGTAGCAGAATGGGCTTTGGAGCCAGTCAGACTTGATTTGGAA
TATTGTTTCCCTAA
gtaattagctgtgtaatcttaagcagattttctgaacctccattttcaaatgctttaaat
ataattaatacatatgccattgggcatttgtatattaaatgacatgtttaaacactccac
tacaggatagacactcaacctcatattgaaaaaaaaggggaagaaaggatttggaggaag

Exon 36 +     135056     135163   2   Internal    108   100   Excellent
ttcttttcaatttgatttattaattaataaatataagtaaaatagttaaaataataagta
aaaataagttttaaagggtattttttcccattattaatactataagaataacatgaacat
atggaatattgttgttttagaataaatgttaaaaaataatatcatggttattcttgttag
GGTGATCGTGGAGACCCTGGGCCTGCAGGTCTGCCAGGCTCTCAGGGTGCCCCTGGAACT
CCTGGCCCTGTGGGTGCTCCAGGAGATGCAGGACAAAGAGGAGATCCG
gtaaggagggagtcaatttcacactgacagttttgcacacccatatgctatgttataagc
tgcatataggcacacacacatagtcatacatgtgcacttcgttaaggactctaaataatg
aatggtaaacagctaattatgaactactatatgtttcttagtctgaaaggcaaaatttca

Exon 37 +     135750     135784   0   Internal     35    65    Marginal
gatttcaattaattaatcataagagtatgcacacacacacacacacacacacatatatat
atatgcatccaactataaacgtattgttgacatcctgtatctatgtaatatgtgaatatc
ttttttacatgccaattttttttgttgtaaatttcttttagggttctcggggtcctatag
GACCACCTGGTCGAGCTGGGAAACGTGGATTACCT
gtaagttctctttttttgttttttaaaaaatgttttcttatataaaatatactcccaaag
aagtataatttaagattcataactgaaaaatatgaaattcctcaagcttgaacaaaaata
ttaattaaaaattataagtttactcttattttttaaagtaatacgagtttatttttataa

Exon 38 +     137705     137759   2   Internal     55    66    Marginal
aaaaataaacagaaatttctaggtctaatactatttttagataagtaaatatattaatcc
atataaaataccaagttcaaaattgtagtaaatacaattataaaaagtaaaattttagta
aattttagtctcaacaataatatgtagcaagtaattttcatgccatatctctatttctag
GGACCCCAAGGACCTCGTGGTGACAAAGGTGATCATGGAGACCGAGGTGACAGAG
gtcagaagggccacagaggctttactggtcttcagggtcttcctggccctcctgtaagtt
attcctttaagtattattctgccctgtagttgaaaatacacgggtatcttgacacgaaca
tttatctgtctgtaaaataggtggatatgtttgtatcttattttcagttcaaagaatatc

Exon 39 +     138140     138243   0    Initial    104    98   Excellent
attgccaataataagctataattttgtagggaagaaataaagcaaaagctatatgcactg
ttactcctacaggtgtctttaacattggtcaactcatgtagacattgcagagattggtga
ctttatcaaagtagttcatgctgctaaagtcaatgatagcacatttttgagaatggcaca
ATGCAGGATCCAAATATTTTGGCAACATTTTTTATTGTATTCCTACTTAGGGTCCAAATG
GTGAACAAGGAAGTGCTGGAATCCCTGGACCATTTGGCCCAAGA
gtaagtaacaaaaagtagtaagttgcaggtgtaaataataatgcctttgttgatgtactg
ctaatgcttgagtatcgttttcctggtattgaagctggagttggctcatcttctctgagg
ttggcaacacacatatgagacaagctatttagcaattaattttaagtagaaatatcttga

Exon 40 +     141400     141691   0   Internal    292    89        Good
atccttgaatgttacagcctgttagaccacccccatctagttacaaaagggcgcgagtca
tagatctccctttactgtcaaattggagtgtctcattggaactccctatgaaccaagttc
taccagttaagtaaaacaaaaacaatgtgttaaatgtctttccaatctctttttaattag
GGCCCTCCTGGTGAGCCTGGCCCACCTGGCCCTCCGGGTCCCCCTGGCCACCTTACAGCT
GCTCTTGGGGATATCATGGGGCACTATGATGAAAGCATGCCAGATCCACTTCCTGAGTTT
ACTGAAGATCAGGCGGCTCCTGATGACAAAAACAAAACGGACCCAGGGGTTCATGCTACC
CTGAAGTCACTCAGTAGTCAGATTGAAACCATGCGCAGCCCCGATGGCTCGAAAAAGCAC
CCAGCCCGCACGTGTGATGACCTAAAGCTTTGCCATTCCGCAAAGCAGAGTG
gtgagtagacagcagcccatttgagcaaaacccgttgtttctgattgtttattctcaact
gcattccaaaatatgttactgactttctacttagtgatagatttgagataaaaatagtaa
acatatcatggagcttataatttaatggtggaaacagtcaattttgtgaaaacatgaaaa

Exon 41 +     144160     144347   1   Internal    188    75        Good
actagaatgtagaaaggcccccaatgcataccggttacttttttcgtaaggggcactctc
acttaaaagaatccttaatcagtgagtgtatattttcaaaccctctgttaattcttttgg
agacttatagtcatgattgagattgtctttatttagtaaaatttctattttgaaaaatag
GTGAATACTGGATTGATCCTAACCAAGGATCTGTTGAAGATGCAATCAAAGTTTACTGCA
ACATGGAAACAGGAGAAACATGTATTTCAGCAAACCCATCCAGTGTACCACGTAAAACCT
GGTGGGCCAGTAAATCTCCTGACAATAAACCTGTTTGGTATGGTCTTGATATGAACAGAG
GGTCTCAG
gtaatttaatatgtttacttaaaattgtattctttactttttactacttattacatattt
ttgatttatttaggactttgctatttttttaaaccaggcttattttaccatgtttatttt
gaagtgatatagtctcattagttacaattgtaataccattgcataaacaaggttttgcta

Exon 42 +     145808     146047   0   Internal    240    92   Excellent
atagacattttaagatatgtttagatgtacagctagaatagcttactttatgacaagaat
taaagtaatactcttcaaaattgatttatctgaaatcaatttatatatttatctatacat
gtgtaaggcattatgaaacccttcagtcttgtgtatgacaaagactctttgtttttctag
TTCGCTTATGGAGACCACCAATCACCTAATACAGCCATTACTCAGATGACTTTTTTGCGC
CTTTTATCAAAAGAAGCCTCCCAGAACATCACTTACATCTGTAAAAACAGTGTAGGATAC
ATGGACGATCAAGCTAAGAACCTCAAAAAAGCTGTGGTTCTCAAAGGGGCAAATGACTTA
GATATCAAAGCAGAGGGAAATATTAGATTCCGGTATATCGTTCTTCAAGACACTTGCTCT

gtaagtactttttgatctacattgatctggttgaggaaaaaaaattatttttgttaaaaa
tactattacagcactagaactgggggcaattttaccttgtatatgagcataatagcagtt
tgtttatagtcattccttagggtaaatgtgtgtgtgttagcacatgaagcatgatagagg

Exon 43 +     146747     146893   0   Terminal    147   100   Excellent
tgaaagaaattctgttacataagtacactaatatttcactttatgttttcattccttttt
tttaagtagtactctaaaaatcattgcctttacattataaaagtgtctgggaaggttgct
gtctaacatacttggaaaaaattgtatgtacatttaacccattgcatcatttaatttcag
AAGCGGAATGGAAATGTGGGCAAGACTGTCTTTGAATATAGAACACAGAATGTGGCACGC
TTGCCCATCATAGATCTTGCTCCTGTGGATGTTGGCGGCACAGACCAGGAATTCGGCGTT
GAAATTGGGCCAGTTTGTTTTGTGTAA
agtaagccaagacacatcgacaatgagcaccaccatcaatgaccaccgccattcacaaga
actttgactgtttgaagttgatcctgagactcttgaagtaatggctgatcctgcatcagc
attgtatatatggtcttaagtgcctggcctccttatccttcagaatatttattttactta

--------------------------------------------------------------------------------