--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (18818 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        324       1548   0    Initial   1225    93   Excellent
ccccggcccgcccctggccgccacttgtttactccccggcgcagcctagtccgaccctgg
ggcccgcccccgcccaccgcctattggccgaggaggcgcgaagagccgtaacgattggcc
cggggaggcgcggggcgagcggggtaggctgcgcgagaggccgagagggggcagcaggcg
ATGGCGGCGGCGGTAGCTGCGGCGGGTCGGTTAGGCTGGTTGTTCGCCGCGCTCTGCCTG
GGCAACGCCGCGGGGGAGGCCGCGCCGGGCCCGCGAGTGCTGGGCTTCTGCCTGGAGGAG
GATGGAGCGGCGGGCGCGGGTTGGGTACGCGGAGGGGCGGCGCGGGACACGCCGGACGCC
ACCTTCCTCCTGCGCCTCTTCGGCCCGGGCTTCGCCAACAGCTCTTGGTCCTGGGTGGCC
CCGGAGGGGGCGGGCTGCCGGGAGGAGGCGGCCTCCCCCGCGGGCGAGTGGCGCGCGCTG
CTGCGCTTGCGCCTGCGGGCCGAGGCCGTGCGCCCGCACTCGGCGCTGCTGGCGGTGCGC
GTGGAGCCGGGTGGCGGGGCGGCTGAGGAGGCGGCGCCGCCCTGGGCTCTGGGCCTGGGG
GCGGCCGGGCTGCTGGCGCTGGCAGCGCTGGCGCGAGGCCTGCAGCTGAGCGCGCTGGCG
CTGGCGCCTGCCGAGGTGCAGGTGCTGCGCGAGAGCGGCTCGGAGGCGGAGCGTGCGGCG
GCGCGGCGTTTGGAGCCCGCGCGGCGCTGGGCCGGCTGCGCCTTGGGCGCGCTGCTGCTG
CTGGCCAGCCTGGCGCAGGCGGCGCTGGCGGTGCTGCTGTACCGCGCGGCCGGCCAGCGT
GCGGTGCCCGCCGTGTTGGGCAGCGCGGGGCTCGTGTTCCTGGTGGGAGAGGTGGTGCCG
GCCGCCGTGAGCGGGCGCTGGACGCTGGCGCTGGCGCCGCGAGCGCTCGGCCTCAGCCGC
CTGGCCGTCCTGCTCACTCTGCCCGTCGCGCTGCCCGTGGGGCAGCTGCTGGAGCTGGCG
GCGCGGCCCGGGCGGCTGCGGGAGCGGGTGCTGGAGCTGGCGCGCGGCGGCGGCGACCCC
TACAGCGATCTCAGCAAGGGCGTGCTGCGCTGCCGGACCGTGGAGGACGTGCTCACGCCC
CTCGAAGACTGCTTCATGCTGGACGCCAGCACCGTGCTGGACTTCGGCGTCCTGGCCAGC
ATCATGCAGAGCGGCCACACGCGCATCCCGGTGTACGAGGAGGAGCGCTCCAACATCGTG
GACATGCTCTACCTCAAGGACTTGGCCTTCGTGGATCCCGAAGACTGCACGCCGCTCAGC
ACCATCACTCGTTTCTACAACCATCCGCTCCACTTCGTCTTCAACGACACCAAGCTGGAC
GCTGTCCTGGAGGAATTCAAGCGAG
gtaacggcccgggcatggtgcaggggacgcccgtgcgagtgccctctccctgaaaagggg
tggagagttatggaagccttctggaaagggtcccacccctgtggagagcagtgagacctc
taaggtcccttttcaagacggtattggccttgcagcttggaatgaccttttgaaatactt

Exon  2 +       9104       9247   1   Internal    144   100   Excellent
agttctcataatcacgctgggagtcttaagtaaaaacctagaaaagagtgtggctctgtg
cctggcacgttgtaggagcatgaacgttagccgtgtccttttggtgggcctataccaggg
gagatgaatcaaactggggggggcccagcaagctgttccatgagtgtcctccccccacag
GGAAGTCCCACCTGGCCATCGTGCAGAAGGTGAACAACGAGGGTGAAGGCGACCCCTTCT
ACGAGGTCCTGGGCCTGGTCACCCTGGAGGACGTGATCGAGGAGATCATCAGGTCCGAGA
TCCTGGACGAGTCTGAAGACTACC
gtgagtccagactcttggcagttctgtctccgctgggcctgcacacttccccaggcgtat
gttgcgtcagaggccagtgggcctctgtgctgctggaacccagcaagatccacagccagg
cccccttctgagccctgcatgggtgctggcagagagcccccttgcaggagggctcacgcc

Exon  3 +      10879      11028   1   Internal    150   100   Excellent
ggggtgggagcaggccccgtggagggagcggtgctgaggacatgtccctggcgttccgat
gctgctccatcgaggaccccctggcctcaggaggaaggagcaggcgatgcagccccttag
tgtggtcgtgttgactgacaggtggctgatgcctgagcgcgccctcttcttccatcttag
GAGACACCGTGGTGAAGAGGAAGCCTGCTTCTCTGATGGCCCCTCTGAAGCGGAAGGAGG
AGTTCTCCTTGTTCAAGGTGTCTGATGATGAATATAAAGTAACAATCTCGCCTCAGCTGC
TCTTGGCCACCCAGCGCTTCCTGTCCCGAG
gtgaggcgggagggtggtccatgccccctgctctcctcaccgttctgtgggtcaggaggc
cgcccagggccgacactgactctgctccccactcctagcaggcgggtgcgtcttgaggac
ttctgtgttctctgcagccctgccagcatcttgggtcatgggagagacacctcctctctg

Exon  4 +      11777      11970   1   Internal    194   100   Excellent
agccaccgcacctggcccctgcctagttctcttgtgttgaggtgttaggggcagctgctc
acaggccacccgggagatccctggtgggcacaataactttaaattgcctacagtgttggg
tgtggttccactggccactaggccccagtggacactgtcccttttttccaccacgtgcag
AAGTGGATGTATTCAGCCCGCTGCGCATCTCTGAGAAGGTCCTGCTGCACCTGTTGAAGC
ATCCCAGTGTCAACCAGGAAGTGAGGTTTGACGAGAGCAACCGGCTGGCCACACACCACT
ACCTGTACCAGCGCAGCCAGCCGGTGGATTACTTCATTCTCATCCTGCAGGTAGCTGTGG
GTCCCAGGCCTGGA
gtccctcctgcttcctcaggccagggaagggtctaggagaagaggggagcaggggcatgc
ggatatgcaccctcccaccccaaacaattgaggtggtgggtttctccttccgctgtcttc
tgacgggaaaggtaatctggccgcatctgtttctctccttgccactcctcccagggcagg

Exon  5 +      12145      12241   0   Internal     97    88        Good
cctggagtccctcctgcttcctcaggccagggaagggtctaggagaagaggggagcaggg
gcatgcggatatgcaccctcccaccccaaacaattgaggtggtgggtttctccttccgct
gtcttctgacgggaaaggtaatctggccgcatctgtttctctccttgccactcctcccag
GGCAGGGTTGAAGTGGAGATCGGGAAAGAGGGTCTGAAGTTTGAGAATGGGGCCTTCACG
TACTATGGAGTGTCGGCCCTAACTGTGCCATCCTCGG
gtaagccacggccctgctgatgctgagggccagggtggaggctgcagagcctgtccccca
tcatcacttgggctctcagtgcccctcctcacctctccttccacctgagcccaccacccc
acaaggtggtgtagcccctgggcttccaggagggagggcagcattcttcatcgctcaact

Exon  6 +      12613      12746   1   Internal    134   100   Excellent
tccacccctgcaaaacctctcccggctgtgtttgtccttctctcccagcttcccatgcac
attgcctctccagagtgattggtggggtgggtcttcgaaactgtacagttgtccccacca
ggggaggaggctcccagctgccagcatggctcctgccatcactgattgttcctttgatag
TTCACCAGTCCCCGGTGTCCTCGCTCCAGCCCATCCGCCATGACCTGCAGCCCGACCCAG
GTGACGGCACGCATTCATCTGCGTATTGTCCCGACTACACCGTGAGGGCGCTCTCTGATC
TGCAGCTCATCAAG
gtgactgcctgggctgcttgtgggtgctggctttagccgactttgtgtcaccgggggcta
gaccagctggtctgagactgcccggaacaaggccttccactcatcctgagggacacagac
ctttgcacccagtttccaagcaaggtcttaaaaacacttgactcagttgctcttctctgc

Exon  7 +      13042      13191   0   Internal    150    92   Excellent
cagacctttgcacccagtttccaagcaaggtcttaaaaacacttgactcagttgctcttc
tctgcccttaactagcttaaagttgtgcctctgtcctcttcgggcacggtgtcacctttc
ctgcctaccttctgcatctcgcttcaccaattgggtcccagtaacgctgtcatcctccag
GTTACGCGACTGCAGTACCTCAATGCACTCCTGGCTACCCGAGCCCAGAACCTGCCACAG
TCCCCTGAGAACACCGACCTGCAGGTTATTCCAGGCAGCCAGACCAGGCTCCTTGGTGAG
AAGACCACCACAGCGGCAGGTGAGTGCCAA
gtggtacatcgtgcatggtgtctggacctgagggccgtgagctcacacacacagacttgc
actctcgccgcccccccaccctctgtcttttttctctcttttctccccatccttttccct
tctttatatatatatatctatatataaataattttttttttttttgagatggagtcttac

Exon  8 +      14572      14665   0    Initial     94    64    Marginal
gccagagggctgctagctgttctgcctgttctacagggcaggaatgagagccagagagaa
ggcccagggactctgacctgcttcctgtaggcctcccgtggagccactgtggctgctcag
acccacactcgagagcacaaacatgtttttctaatagtcctttctgaattgtgaggtcac
ATGCAGGTGCAAGGGACAGAAATCCCACCCTGGGCCATGTGGATGCTTCAGCCCCTGTGG
GCTCCAGATCTGGGTGTTGGCAAAAAGGCAGCGG
gtgaggtcgtgctgcttaagtcttggatctggggatgggttgcatctcttcctaaagaga
tctctctaaggatggtgctgcacttttttttaagagataaggtcttgccatggtgcccag
gctggcttcatactctgggctcaagtgatcctcctgcctcagcctccaaagtagctggac

Exon  9 +      17525      17554   0   Internal     30    70        Good
ttctctgcccacctgctgagttgccactcgcagtgttgtcagttcccgtgttctgagaag
aggtcatgcctgggaggaagggatcgtcatgctgcatcgaatcctctctccgccgtgtgg
cccccaggagagtagctgcctgttgcacctgctccacacctccccacagcctccctgcag
GTGCTGTGTGGCCGTGATGTGCAGAGAGCA
gtgagggagggttcatgaaccaggtggatcctctttaaaaaaaaaaaagtttttgttata
tctctagaacatttcaagtcttttcctttttttctgttcctagctatggggttttagaga
agtgggaacaggaaggcatttgtctttttcttctagtttactacattttccttccgtagt

--------------------------------------------------------------------------------