--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (47287 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3732       3839   0     Single    108    43    Marginal
aaagcgtgggaatggatagaaaaagaagagtaggggatgactctcagactagggtgccgc
tacctcttggggttgaaagtgtcagagcagggcagctggaggggaacagagtgactccac
tgaagtcatagtttaggaggaggctgtacaaagagggtgtgcctgtgccggagagaagag
ATGATGCCCCAGGGCTCCCCCAACAGTCAGGCCAAGCAGGCCATGACTCCCTGGAACTGC
TCAGAGGTCCTGTCAGTACATGGGGGCACTGAATTGGATGACCACTAA
gttccttctagcctcatatttggttcagctgcaatgagcgacgccagggtgcaacttcca
caaaggccgagcggatgttcctttgctcagggaaagctgtgtccaggtcgtggcaactca
aggtgtacacccatgctccagggagtcttattctctgcaaagatttgtgactatgcagtg

Exon  2 +       7718       7759   0   Terminal     42    49    Marginal
tggcttaactaggaattacaattaaaagtgattaagaatggtagtaatcaccattcttat
cttctgtttaaggaaatatcttttatctttcctcagaaagtatggtgttcctctagattt
ttttagtaaatatcttttcttgggttaaataaatttcattctagcccaaatttatcctag
GAAAATAATTCGGATGTGCTCAAAGACATAGTTAAACTCTAG
taatactgtcactgtttagtgaaaaagaagaaataacatgaaattccagaaacagtagat
tttaaaaataaattttggttgacctatgatttggcatgctttgcaacaactaaatacgtt
cttgtatattcaacttattggcaaaggcaagtgttcattagatattgtcaagtaaaaaaa

Exon  3 +      13267      13491   0    Initial    225    77        Good
ctgcttctgtctctttctcaccagctgacttctccgctcccattctctccatccttcccc
tcgtctctgtggcaatggcaaagcacaaggaggaagtgaggaaactgaccgtcctctctc
catttcaggagcagcagagactcctcaggaagactcactggactgtacccaccacctgcc
ATGTCTCTGTGGCCACCTTTCCGATGCAGATGGAAGCTGGCGCCAAGGTACTCTAGGAGG
GCGTCTCCACAGCAACCCCAACAGGACTTTGAGGCCCTGCTGGCAGAGTGCCTGAGGAAT
GGCTGCCTCTTTGAAGACACCAGCTTCCCGGCCACCCTGAGCTCCATCGGCAGTGGCTCC
CTGCTGCAGAAGCTGCCACCCCGCCTGCAGTGGAAGAGGCCCCCG
gtgaggcaaaatgtgtcagcccagaccctccttccccagggtttagggctttcagatact
gcgcctaagatatatgggagaaaaaaacaggctttttcctactctctcctctccactcaa
cacaacacactcttctaacaccagatgtgtaggaggttttccccacatgccaagcaattc

Exon  4 +      16462      16580   1   Internal    119    86        Good
atttcagccaatgctcccagccccacctctgctcactcatcatccgccttcccagtatat
aattcccttctcctaaactgggctacaagcccagagagggtggccattgggaccgggcat
tttctgcagtcataaagtccccagtagattcatgcagatgctgtgtgctgtctgacttag
GAGACTGCTGGTTCTTGGCTGCTTTGCAAGCTCTGGCCTTGCACCAGGACATCCTGAGCC
GGGTTGTTCCCCTGAATCAGAGTTTCACTGAGAAGTATGCTGGCATCTTCCGGTTCTGG
gtgagtgtcttcccgggtcctcagcccagagggagtcataggaaaaagggttcctggagg
accatgtcttcaccttctgggctgatcaccatctgcagcagtcctcattcacccggggcc
actctctccctccagttctggcactatgggaactgggttcctgtggtgatcgatgaccgt

Exon  5 +      16716      16852   0   Internal    137   100   Excellent
aatcagagtttcactgagaagtatgctggcatcttccggttctgggtgagtgtcttcccg
ggtcctcagcccagagggagtcataggaaaaagggttcctggaggaccatgtcttcacct
tctgggctgatcaccatctgcagcagtcctcattcacccggggccactctctccctccag
TTCTGGCACTATGGGAACTGGGTTCCTGTGGTGATCGATGACCGTCTGCCTGTGAATGAG
GCTGGCCAGCTGGTCTTTGTCTCCTCCACCTATAAGAACTTGTTCTGGGGAGCACTTCTG
GAAAAGGCCTATGCCAA
gtaagaaaccggcagaaatatcccccttcccatcgcttctttttctctctctcaatgttg
agggaggggagtggagtcaggtaaagtttatgaaatgagatcctgaggcatgtcttagcc
aacatagaagtgacaacgtattcagtcttttatgtaggggtcacctcatctaaacctgca

Exon  6 +      18089      18263   2   Internal    175   100   Excellent
gaccaccagctggagccattcaggatgggtatggtattggaaactatgtcagggttgcct
gagctctgcttttggtatgagaaaactagactcctatttaaaagtggatgccgaggccac
ataaaattataaatactcatgatacttttttcctctcatgtttatttcttccctggccag
GCTCTCTGGTTCCTATGAAGACTTGCAGTCAGGACAGGTGTCTGAAGCCCTTGTAGACTT
CACTGGAGGGGTGACAATGACCATCAACCTGGCAGAAGCCCATGGCAACCTCTGGGACAT
CCTCATCGAAGCCACCTACAACAGAACCCTCATTGGCTGCCAGACCCACTCAGGG
gtgagactgggctgccactggcagaatgtcctcttctcctgcacccatgccctccatcca
ccaccactaccctcacctgggtgtgggctcagggcctccacccagctcctagtgctgagg
tcctggtgttcaaaccagagcagcaaggccaggtgcggtggctcacacctgtaatcccag

Exon  7 +      19182      19244   0   Internal     63   100   Excellent
tgagagggtggaatgagactatggataccaaagagctttgaaaactgcaatgtaccatac
catgattatctcccacacttctctccataaacccctgctccagccaaacagccttcccac
gactcaaagaataagctgtacataacagaagactgatcaggacctctcttgtctctgcag
GAGAAGATTCTGGAGAATGGGCTGGTGGAAGGCCATGCCTATACTCTCACAGGAATCAGG
AAG
gtgggttgaggttggcccttcggtttccctctcagccttgcccttccctctctggaccct
agcttatcttggtggatttagtttctgtaccatctggagagtgggtaaagtctttggtgg
gtccctgtgcctcggcatctatttcctgcggtgaagtggtgggtccaggctttgccacca

Exon  8 +      19761      19921   0    Initial    161    61    Marginal
ctctgacacacttctttatgacagtctccattgctatccatcttttgagctctactaggc
attgagaggaagacacaccaggcaggacctgcctacaaagggcttacagtcaggtatggt
cacaaaccatatctgaaaatgaggaggaagcaaagttgaaactgagagaagagagtgtag
ATGAAAGACTTTAGGAATTCATGGATAAGAGAAAAGACCTCCATCGAGTTGGGCTGGGGA
GAAGTCAGAAGAGTCTCTTACAGAGGAGGTGATGTTGGGTTGGTCCTTGTAATGGATAGA
TTTGCACGGGGCGAGAAGGGCATTCTGGTGGAGGGAGCAGT
gtaagcaaagcatggagataagaagtcagcaggtttaagttaaagaacctctgatattct
ctagagggcccaactcttcccaagtactccagtttcctttaactctgtttcaaatttctt
ggactcaattcacacttaacttcttccttctagatctccaacaactatgttggtctgtgt

Exon  9 +      21380      21465   0   Internal     86    80        Good
atttgccctaggtctcacagcttgtaagtacaagaagcagagccactttctcctctacca
gctctctctggggctgtgattttccactgcaagtgctcagctccaggcccgagtctcact
cagatctctggaatgtttgcactcagcccagtcacctaaactgcctctcattttatgcag
GTGACCTGCAAACATAGACCTGAATATCTCGTCAAGCTACGGAACCCCTGGGGAAAGGTG
GAATGGAAAGGAGACTGGAGTGACAG
gtgaactttggggacatcttggaggggtgagaacaggtaggttaggcaaaggaggctgcc
atttgcacacagattcaaatgtgtgctttctttggtcttaggctggatcaggaagccttt
agacggggaagctcaatccctcacatttagaagatgctttatggtatagagactgctttc

Exon 10 +      24231      24318   2   Terminal     88    82        Good
ccagtgcttggctcatagtaagctatcaattcatgttcatgctactgtataatatggaat
gggaaatttagttgtctgaggtagtatgaaaataataataaataatgacactatagagcc
tttactaaagaatttctagcatgctccccacaagcttttcattcccttttctattttcag
TTCAAGTAAATGGGAGCTGCTGAGCCCCAAGGAGAAGATTCTGCTTCTGAGGAAAGACAA
TGACGGAGAATTCTGGTATTGGACTTAG
ggacttggacaaatgtcctggcctacatttgaaaacccatccagcagacatttattggat
gccttatgggtgccaggaacttcatgtacagagatcaataaggcaccatccctttaggag
ctcacggtctagcaggacaaacagtgcctgtaaataaacggtcactgtctttgtgatgag

Exon 11 +      25133      25196   0    Initial     64    52    Marginal
ttatggttaagtaaactgagcatcagacagcttaaatagagtgtcgcaggccacaagtta
gcaagtaggggcaaagatcttcatgaattaatgattaagaactgatatgtaattcttatt
gaacatttatagataaaacaaatgactagttagctatgccttaattcagctgctatcacc
ATGATTCCAGAAACTGGAACATCTCCCCCGGTCAGCCATGTGGCCGGCTGCTTCCAGCCA
GAGG
gtggggcttctcagtagctccagccccccacgatggaccctcacagggatctagccagcc
ccagctgatgtgcctatcgtcagctcagctctgcacaagagctggtgtctttgtccatga
gagggctgggatgcccactgctccgtttcaccctccccatgggtcctgataactaggcgt

Exon 12 +      25421      25615   0    Initial    195   100   Excellent
agggatctagccagccccagctgatgtgcctatcgtcagctcagctctgcacaagagctg
gtgtctttgtccatgagagggctgggatgcccactgctccgtttcaccctccccatgggt
cctgataactaggcgttatctggtccatctctttgtgcttttccttcttctctccacagg
ATGACGCTGCAGGACTTTAAAACACATTTCGTGCTCCTGGTTATCTGTAAACTGACCCCA
GGCCTGTTGAGCCAGGAGGCGGCCCAGAAGTGGACGTACACCATGCGGGAGGGGAGATGG
GAGAAGCGGAGCACAGCTGGTGGCCAGAGGCAGTTGCTGCAGGGTGAGCATGTGCACAGG
AGCAGGGCTCTCAGG
gtgaggttgtgggcgggggtgtcagaatgactgcacagggggttgcagcacgaattctgc
attggctgagtggggaggaggctctgcttgcctcactgtgtgttggggccctgggctata
accacagggaagatggggtacctttggacccaatgtgcaccaaggcagagtcctctcagt

Exon 13 +      26366      26447   0   Internal     82    73        Good
ttagctctggagtcccccttttgacacagtatttcccccatagtctgaagctgaccttaa
ggtaaggttttgcgtctattaaaatgcaaaggcccctaggatcatggtcacctccccagg
gagttaatacaattgcttactcaggtagcacatgcttgtggggtataacacctgggccag
GCACTGAGCAAGACAAAGGCTACAGTGGTGGGAACAACTCCAGTCAGTGTGTCTGGAGAA
GACCTCCAGGTGGAAGAGCAAG
gtgggagggcgtaaatccaaggttgaagggaccccgactctgtcccagtgggcctcaggg
tgtcaatcctggcagaggcgtcctcagactgttcacctcttagtggttcggcaagcagga
tgcatggggatccggggcccattctcaccttgctgtgttctgctccagacacattttgga

Exon 14 +      26616      26772   1   Internal    157    74        Good
tggaagagcaaggtgggagggcgtaaatccaaggttgaagggaccccgactctgtcccag
tgggcctcagggtgtcaatcctggcagaggcgtcctcagactgttcacctcttagtggtt
cggcaagcaggatgcatggggatccggggcccattctcaccttgctgtgttctgctccag
ACACATTTTGGAAGAACCCGCAGTTCCTGCTGTCTGTCTGGAGGCCCGAGGAGGGCAGGA
GATCCCTGAGGCCCTGCAGCGTGCTGGTGTCCCTGCTCCAGAAGCCCAGGCACAGGTGCC
GCAAGCGGAAGCCTCTCCTCGCCATTGGCTTCTACCT
gtatagggtaggtggacctctgaaccacaggggcatgggaccaagcgtgggggtcaccaa
cagttaccatgtcttcctgtttcctgtcttcttcaccatctgtctctgttcacagacctg
ggttttcaaatccaggctctgtcctttaggaacatgtgatttagaacaagtcaccttctt

Exon 15 +      27739      27837   2   Internal     99    89        Good
cagagaaccaatacattttagaatttattaaattcctacacaaatacccagggctaatat
tgacggccatcacagcataggaaagatgataaattacaatcatgactgggttatgaaacc
caaaataaaatagatttaaaacatatgggacatcaaagaccatgcagcccacctccctag
GGAGAAAGGACAAAGGCTTGGGGACATGTGGCAGGAGCATGAGCAGAGGGACAAGAACAC
CTCCGTGCTTCAGCTGCTGTGGCCGCCAGGAGGGGTCAG
gtaggaaggcccaaggaatcccagcttctgagggaggcagctattattttatttcccaaa
gaaaacaggagtaaaatgcttaattttctcaggttggattgaatcaagtaaaaggattat
tgtagagaaaccattttacgcagggtctttgtttgttgtttctctcacaggaatactgaa

Exon 16 +      28579      28714   0    Initial    136    42    Marginal
gatgggtgatgtctttgttagcagttgtgtataaactggagagaggatcctggtatgggt
ctcctctccctctatagccctgagtgagaacaaaggggagagtaagcaagagagaaaaat
agggagagatggagaaacaaaggaggcagagagagagagagagagagagagagagagaat
ATGAATCAGATAAAGCAGATACCCAAGAAATGTCGGAACCAGAGCCCTGATTTTGGTCTT
CTGAGCTCTTGCCCAGTTCTCTTTGTCCTTTACAAGGGTGTTTTCCCTGAGATGATGCGG
AATGTCCAGCTTATCT
gtgtgtagctgtgtggtgtaggtggggaggtggtcgtggtccatctgtatctgtgtccat
aagtcatgccatatcacatacatggaggcagcatcaggaagggtaaagaacaggagcatt
ggaactcagctgtccttaattcccatcgggctgggactgtacccagctgatgactctggg

Exon 17 +      30360      30396   2   Internal     37    92   Excellent
gtgcacatggctggaatgtacagttcaaggggaagcaggaggtgaggtgtgagagctggg
tgggcccttgtggtgcctcagtgaaggaacgtggaagacgagctcccaggagaaggggaa
gattggccaaaaaattcccaagaggaaactctgagtttgttcttgtttgtttgttctcag
TGAAATTGGCAGCAATTCTGGTGTCGTCTTCTCAAAG
gtgagtagtctggtggaattccatatggctgggactgctttccaagccagggtgttgggt
ttctcccttcaagttaaggagtcaggggaggagatatgcggatccttacagaccctgttc
tatggcaaacattacccgttgtatcctaacagtacctgggctttgctgtttttgcaccaa

Exon 18 +      30900      30956   0   Internal     57    99   Excellent
gagtcaggaaaaattggagaagcaagggctgtttgtaaatgctatggtgtaaaattaaag
acgatgcaaagtcaagctcatggatttcagaaacctggaagccatgagacattagggtgt
gcacgaaagtccgtttatacaggtgaataattgtgtctttctgtgtgtctcttcctatag
GAGATAGAAGACCAAAATGAAAGGCAGGATGAATTCTTCACCAAATTCTTTGAAAAG
gttagttgaacaggtgtggtggggggtgaggaagagcaggggacgaagtggagcttctca
ttttataaagtataggtttgcacctgcttgaggctgcttagaaactgtgatttaaggcta
cctattgcccaaactgccactttctattaaagtcctcaagtttttagacaaatgagtgga

Exon 19 +      32229      32286   0   Internal     58   100   Excellent
atcactgttcttgaaagtcatgccctgccagggttctctggggttggcacccagttaaaa
agcattgtgaagttcttaggaaatcccagtttaatttcatggccagtcatatgacccctc
tgccatctaatgagccttcagtaacagttattttttcttgccaatctgctttctatttag
CATCCAGAGATTAATGCAGTTCAACTTCAGAACCTCCTGAACCAGATGACCTGGTCAA
gtaagtgttttagagccattctgtaggactcagaggggatgcaacttttctaaactctgg
ctttgtttctctttcccttggtgggatgtgtgaattactgagcactggtctcaactctgg
ctatattttacacaaggtggattatgtgatctgaaaaagcagtagggaaatttatacaac

Exon 20 +      33563      33691   0     Single    129    40        Poor
atttacaacaaatcttatcaccattcccaagagttatacaaatataaaactagagggata
attctatccagttacaggcaagagtctatatgcttagatgtttagatgagagttcttaga
ttctgtctgcccttggtcctgttcatttccccaatttttattaatgtcttggaagaagac
ATGGAATATAGGCTTATTGGAGCTGCAGATGGCACAAAGCTGGGAGAAATCATTAATATA
ATAGATAGCAGAATTGAAATTCAGAATGTTTTCAACAAGCTGTGCCCAAACCAAAAAGAT
GAAATGTAG
tcaggaagataataaaccactgccattttgatatagaccattttaagatggtagcacaag
ttcttaacagaagagacttcatttttgtggcagtttatgtgaaagatatttggttaattt
agttgacctctagctaacatgaactaattgtttcaagttgctgctaaataagctcgtaca

Exon 21 +      38467      38588   0   Internal    122    70        Good
caaacacactgcctttctaagtggataattgtaatcaatgtttgatcatccatactattg
agaggcatattgaatagatagcctaaggggggttgtaaagacaaaaacagtctgcagaaa
ctcagagacagtgcaggattaggtgcacgggcatggagcaggtcccagctctgtcaccag
CTGTATGAACTTGAACAAGATCAGACCCTCTCCAAGCGCTCATTTCATCACCTGGAACAT
GGGGAGTTAATGCCGACCTCACCTGCTACAGGTGAAGTGTGTAACTCAGTGATGGATTCA
TG
gtgagggctcaaatagagatggggtgtggtggtactttgacccaatgtctctgatggtag
gggtatctgggcatggtctacaaagccaaccattaaacttaaaaaaatgtaaaaggcatc
attagccactgtgtgcctgactccttccataagctggtttttaaaataataatgaaaaaa

Exon 22 +      39868      39950   1   Terminal     83    82        Good
taggcgtgaaaggaagaggcaatgggatatgtcatatttaatttgtttatgtttaggtgt
aaaagacttcaagtatattaaaattatatcaccatctgttaatactactggtactccact
aacaataatcaaagataacatttcatagcattaaaaaaattctgcctcccttaatgctag
CTGTGGTCATCACCATCATCACCTCCATCATCATCGCTTCTCCCAGTGCTGCTGTGCTCT
GGGCTCATTCTGTTTTTTCCTAG
caagagtgagggagccctgggctggactggccagtgaggtgaggcgaactagcgaaatca
gacatgatcagacattgaatgaggccatccacaaattgcacatcactttgtggagggctg
atcactgcctccaaagcatggatagaactctccctggaagcttttaccttaacctattaa

Exon 23 +      40153      40203   0    Initial     51    76        Good
tggactggccagtgaggtgaggcgaactagcgaaatcagacatgatcagacattgaatga
ggccatccacaaattgcacatcactttgtggagggctgatcactgcctccaaagcatgga
tagaactctccctggaagcttttaccttaacctattaatcagcttaatgcatcaggtact
ATGAGCATCCAGGAATTCAGGGACCTGTGGAAGCAGCTGAAGCTCTCTCAG
gtaagaacaagtcttaaccacacctctttggaagatggtgtaggaatggcagttctgcaa
agctgtagaagatacttctgtccccttcagccctttatatccacctcaccaaaccttctc
tattctcccttcggtgagcatttcctctattggtctcttccaaactcagagagctggttg

Exon 24 +      40893      40968   0   Internal     76    88        Good
atgaggcggtaggatcccagcatggactctgccatattcttatcctggcaacaggccctg
catgtggagcctcagatatcttcaacagcccctctgcggtgctgacaaggggcacacagg
gctctcagatggtgcttggaaatgcctggcttcctgaacctcttatttggttctttgcag
AAGGTTTTCCACAAGCAAGACCGTGGGTCAGGATACCTGAACTGGGAGCAGCTGCACGCT
GCCATGAGGGAGGCAG
gtaggcacaggaagagctggagctgtgggcacacacgggcagggtgcacactcatcaggc
agaggagaggggatgtgtggcatgctgaagtaactctaatacgcagtgttactctcaaag
acgtagatctgcagtcaactccaacattttttatgattgtccctgtgatcctagccaaca

Exon 25 +      41515      41688   1   Internal    174    98   Excellent
acttgatgaaaacagcctcatgctggttgccttaacagacaggggtgaagagtagggatt
aaataaaataaattggttaaacaattaaaccattcaaaatgaaccctataaaagaagatt
tccatgctatcaggattcaggtccctaaactggagggacatttgaaggggccttgagcag
GAGGGGAGCTGGGTGCAAGCCCCCAATACCCACAGCAGGAGCTTGTGCTCAATGCAGGAA
TCATGCTCAGTGATGACGTCTGTCAGCTGATGCTCATCCGCTACGGCGGCCCCCGCCTCC
AGATGGACTTTGTCAGTTTCATCCACTTGATGCTGCGTGTAGAGAACATGGAGG
gtaagctggcgggaagctggggagggccaggtcttcctctgctgccccatgacttcccac
ctgtccctagtttaagcacaagggaggacagccgccatcccagaaacagcagaccaggga
agctgtggggacctccagccaagtgcctgtgaaccctggctgcagatatccaaactcatc

Exon 26 +      42072      42127   1   Internal     56    68    Marginal
aaaggcttgaagtggctcacttatcatagatgtggctgcgtgtggtcacatgtaggctga
cactgggttccctcacgttttcagaatggatgtggttaaggtgagacatatgggaggaac
taattcataatgtttccaatagacacattagctgtattcctttctgctgcattttcacag
ATGTCTTCCAAAACTTAACCCAAGATGGCAAAGGGATATACCTCCAGAAGCCAGAG
gtaagacttgccccaaggaggtggctcatgtcatcttacgtagaggtggcccttgcggga
ccatgctcttgtgaaggagaagggctctggggacactttattctgctgaattggaaattg
agcactacattcattgcactcattcattcattcattcattcacccatcaaatattttctg

Exon 27 +      46017      46210   2   Internal    194    69    Marginal
ggtgctagcctcactctcctgagtctaggtatctgcactgtggcaactcaaagatgacct
gtctttgctgacacccttcctccagattctctcctatacccccaaagctgagtactgaag
accagggggcagagcaatctccccactcccaccacgcttccccatcttctgtcactccag
GGGAAGCAGGGGCGGGAAAATAGAGATCTGGGGCAGGAGAAACTGGGCAAGCACCAGGGT
GAAGTCAGCTGAAGGGCTGAGAGTTGACCATCAGCAGTTCTGGAATATCGAAAGCAGAAA
GTCTGCCATGAATAAGAAAAAGTGGAAAGTGCAGCCAAGGAGGAGTGAGAAATCACCTGC
CAGTGCCAAGGAGG
gtgaggtcaaggaatccagaggttgggttgtcaagtccagcccacgcagggaaagcatat
caaagtgaggcctgttccaggctgtcacaatctcaggaaaacaggactctacctgaacaa
gaggagatgaaaatacctaccatttatttatccctggtcttgtttcttctttcatgtttt

--------------------------------------------------------------------------------