--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (23192 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1084       1236   0    Initial    153    77        Good
ccctgaaaaaagcttctgggaaagtaaaaacccgaacaaagtttcgataactaagatttt
tttcctggttaaatacactcaacctgtatttggggtgagtgttagccgggtacaaaggta
gacaaaagttccgagtgccgccgcaatcgtctcccacaacatgggtctgagctactcaaa
ATGAGATTTGCCTTTGGAGAAGAGTTAAGGAGCAGGGGGCGTGGCGAGCAGCGTGAGATC
ATCGGGAAGCGCCGCTCGTGGCGGGGGCAGAGCCGGCGCGTCATTGTCGTCATCGTTGCC
CGACCGCTTTCCGGGAGACTGGAGTCGAAGGCC
gtgaggtatttttctaaggtgtagtttcagtttttctcctgctcctgtttaactccgctt
ttcctctcctgggattcccctgtcatcctctgggcagactgagaaaatcggagtttggct
gcgtagccttccaggaatgcagtctctcacagctcttcgttggggcagcattgttggcag

Exon  2 +       3314       3388   0    Initial     75    52    Marginal
tgtagagatgggaagagccctggaatgtacattatcgtatgtttgtttggatccatgtgg
tgactttctagtatctgtaagctcaaactgtaatctgatattaagagtttccaaaattac
gtcttaggttactttgattggttttagttagtaaacaaatagttgctaactaactaatac
ATGACAAGACATTATGTTAGTGATGTGGAGTTCAAAATGTGCCTCGACATGAATCTTCCC
TTGAGCAATAGCCCA
gtgagtaaataaccaatggaaaggtaggaggagaggagtgacatgatctgacttaggttt
gttttattttattttattttactttattgtcttttgttttcttttgtttcctttcctgcc
ctgctctgcccttgcccgccctgccccaccccatctcgcccctcttttcttttggagtct

Exon  3 +       4252       4398   0     Single    147    41    Marginal
taaggttattgtcaaagtttggggcttgagcaactagaagaagggaattgccattaactg
agaagtagaaaactgtgggaggggcaggtttgtgggaagattcggagttcagttaaggac
atgataagtttttgatgtctgttagtcatctaagtggagatgttgagtaggcagttgaat
ATGTTCATTCTGGACTTCAGAGTGGTCATTGCTGGAAACAGACGTTTGGGAATTGTCAGT
GAACAGATGGTATTTAAAGTTGTGAGACCGGAGACAGTCGTTAAAGGAGTAAATGTAGAC
AGAAAAGAGAAGGGGCACAAGGCCTGA
gtccttaggcattttaacaagttgggaaaatgaggaataaccaccaaatgagacagactg
agcagccagtgagggacaaggacaattttgagtctggtgttgtagaatttacagtagagt
agtatgttcagttttgtcaggtgcagctgatggatcaggtgaaatgaagattgacacctt

Exon  4 +      11062      11138   1   Internal     77    53    Marginal
cctatcggtactttggcttctgtataaccagtgagaggaaggactgagtggcagtaacat
ctgttagggttactgggcagcatccccgcaacccaggtactcagtctcagccacacctta
ctgagtggtgaagagaagcaagttttctcatgccctctccgtctgtctctacctctgcag
CCAGTGTTTTAGAAGGAGTATGTGGAAGGGCAAGGAGTACCTATAGAACCCCGGAGGAGG
GTGAGGAGCAGAGCTGG
gtgagttcttttcttctttggaaattttaacatgtacaactttaggcatgttctttaact
tcttttggctcagtttattcatctgtgaggtttagatgaacaagtgcatgtggaatgctt
agagtagtgcctggcacataatcagtgctattcaagagtttgctgctgatatcgtagagt

Exon  5 +      16880      17035   0   Terminal    156    83        Good
ttaagaaggggacaaattggaatgtagttaatctagaattaaattttaaaaagatttgtc
ttcaggttttaactcttagtgcctttgaaatacatgatatgacctattgatttttttttt
tggaaactaaagaacaagctctgtctctaatatgaattcaaagaatttaattttttccag
TCAGCCATAATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTAT
TTGTCAGCGTTTGAGAATTCCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCT
GTTTCTAGAAATGAGTTGTTGCAGAAGGTATTTTAA
aaatgtaatttcctaaaaatgaatttcataaaacagaatgctattttatgaaacatgtgg
aagaagaaacagattaatgacctatgccccttttcccctttatttcaattttattagtgt
ttgggtatttttaggggggaaacaaaacaaaagaaaactccagccttaggaaatacctcc

--------------------------------------------------------------------------------