--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (83489 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1274       1431   0    Initial    158    80        Good
gagcattgcggccgccgtgccccgcccctccccgcgcgccccgcccctctggcggcccgc
cgtcccagacgcgggaagagcttggccggtttcgagtcgctggcctgcagcttccctgtg
gtttcccgaggcttccttgcttcccgctctgcgaggagcctttcatccgaaggcgggacg
ATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCT
CGTTCCGCGCCCGCCATGGAACCGGATGGTCGCGGTGCCTGGGCCCACAGTCGCGCCGCG
CTCGACCGCCTGGAGAAGCTGCTGCGCTGCTCGCGTTG
gtaaagacggagcttcttgggggtggctgcgagggcacgggtcgcacagtttctgggggc
ggcagaatcttttcaaatcttccgtttcctccttccgttcccgcgctgcagtcgggtcgg
cgtgcggttagcacctgccgggggatatagtattaacaacttctgcttctcattcacttt

Exon  2 +       4404       4637   0   Internal    234    60    Marginal
ttacaggcgtgagccaccatgcctggtctttacatgggctttaatgtttagaaatgattt
tgctttcctctgtaggtgtctctgcaactttggcactatctatagtgaaaaaagcatggc
cagctgcaccttactcaaggaggaaaagcattgttcctacctctgcctttgccctggtag
CCTCCTGACATTGCCGGCAAGGAGCAACTCAGAATGGTCTGCTTCTTCCATTTGCTACCC
TCCATTCAAAGCAGTGTCATATTATTTGAAATTGTGTCAGTATGTCCTTTTACAGAGTTT
CAGAGTTCTACCCAGTGGGCTAGTGATTACCCCGATTACCCTCACATTCAGCTTGCAGCT
GACATCTGCCTTGTGTTGCACATGGATCTGTTTTGCAGCAAGCATTACTTGCTG
gtgagggtggattggtacataaccgggcatcctttcttgacctttaacatgaatctggct
tcaaggtgaagccgatgaaagtgttcaagaggccagatgtgacatttatattaggaccaa
gcctcacaaccagaaagaagctatttaaggatttggaaaaatgagacaggaagaccatat

Exon  3 +      17618      17810   0   Internal    193    85        Good
aattagatggtcccaaaagtctcttccagctctggtatgggttacagattcattttacaa
ttttttttgagttacattctgtcagaaatcatgctagaagccaaggatacaagaattaga
aatggcataggttttgtttgaggatagttcatattgagtaagaatcctctctgcctacag
AGGATTGGGTCCTGTGACAAGGAATGTCCTGTGGTGCTTGGGGAAGATGTGGCTTTTCAA
CTGTTACATTACTTACTCAGTCCTACTGGAACCCATCTGGTGAGGCCAATGAAGGAGGAG
ATTTATAGAATTCTTATTCTGGAATTCACAGATGGGCTTGTGGGGGGGATCGTGAATCCC
TCTTTTTACATGA
gtatgtatagattttcatcagatttgcaaaaggtctataaaccccaaaattagaaaaact
cttctaactctgaaactttagtccttagataacccaggtaattgagtctacaggttttaa
aattgtctgaaaaagtcaaagatcttttcccaaaagctactttaaagccttgagatacta

Exon  4 +      19393      19433   1   Terminal     41    59    Marginal
ggttaacgttttttaaattgtccttagactctgtgtattaactgtgtatctttccattgt
gctttctgctgagaactaattaactgtggaaagaaagtaaaatgttttgtatcttcataa
ttggatattagagttgtctttttattgaccagatcatgctattttagtgtgtgtttgtag
AAGAACGTGTTCTTGACTGGCAGGATGCCATGGATGATTGA
taatgctcatataaaattgttagatttctatttttaaatcttttgttcttagaatcctgc
catgatgtcttattgtcagctaaagatgaagttgattatacaaaataaataaatgtggca
aaaactttgagtcttaccacaggtccatatttttaagaattagaacttaaatcactttat

Exon  5 +      29334      30301   1   Terminal    968    80        Good
cagtaagtattgaatgagtgaatatctgctatcaaagagttcacactctaggagctgaga
aagaagtacataattaaaagatgatacactttaggggaactgtaaacaaaattcttcggg
agctccatgtgggagcaataaatttcatgtaacagatttctttttctttttttctgtcag
ATTTGAAAGAAGATAAACCTAGGAAAAGTTTGTTTAATGATGCAGGAAACAAGAAGAATT
CAATTAAAATGTGGTTTAGCCCTCGAAGTAAGAAAGTCAGATATGTTGTGAGTAAAGCTT
CAGTGCAAACCCAGCCTGCAATAAAAAAAGATGCAAGTGCTCAGCAAGACTCATATGAAT
TTGTTTCCCCAAGTCCTCCTGCAGATGTTTCTGAGAGGGCTAAAAAGGCTTCTGCAAGAT
CTGGAAAAAAGCAAAAAAAGAAAACTTTAGCTGAAATCAACCAAAAATGGAATTTAGAGG
CAGAAAAAGAAGATGGTGAATTTGACTCCAAAGAGGAATCTAAGCAAAAGCTGGTATCCT
TCTGTAGCCAACCATCTGTTATCTCCAGTCCTCAGATAAATGGTGAAATAGACTTACTAG
CAAGTGGCTCCTTGACAGAATCTGAATGTTTTGGAAGTTTAACTGAAGTCTCTTTACCAT
TGGCTGAGCAAATAGAGTCTCCAGACACTAAGAGCAGGAATGAAGTAGTGACTCCTGAGA
AGGTCTGCAAAAATTATCTTACATCTAAGAAATCTTTGCCATTAGAAAATAATGGAAAAC
GTGGCCATCACAATAGACTTTCCAGTCCCATTTCTAAGAGATGTAGAACCAGCATTCTGA
GCACCAGTGGAGATTTTGTTAAGCAAACGGTGCCCTCAGAAAATATACCATTGCCTGAAT
GTTCTTCACCACCTTCATGCAAACGTAAAGTTGGTGGTACATCAGGGAGGAAAAACAGTA
ACATGTCCGATGAATTCATTAGTCTTTCACCAGGTACACCACCTTCTACATTAAGTAGTT
CAAGTTACAGGCGAGTGATGTCTAGTCCCTCAGCAATGAAGCTGTTGCCCAATATGGCTG
TGAAAAGAAATCATAGAGGAGAGACTTTGCTCCATATTGCTTCTATTAAGGTAGGATGCT
TACTCTGA
aataccatctcagaatgaggccaactataaagcaatttctttgcagtttttgaaaaatgg
cataggattactaggataattaacctttcacagacatgatacttcctctgaaccagagaa
gccagattcatagggagagcatctctacttcagttggagcagtggcccctgagtctgggc

Exon  6 +      35742      35889   0    Initial    148    70        Good
aaggaagagtcactcatctcttactttatataagaagctagaaatgatgagtgaggaagg
catgttgaaagttgagataggccaaaagctaggtctcttgccaaacagccaatttgtgaa
tgcaaagaaaaaattctttaagtaatttaaaagagctaccctgttgaatacacaaatgag
ATGAGAAGAAAGCATAACCGCCTTACTGCCGATATGAGGAGAGTTGGAATGGTCTGGATA
GATGATCAAACCAACCACATTTCCTTAAGCAAAACCCTACTCCAGAGCAAGATCCTAAAT
CTCTTCAATTCTGTGAAGACTGAGAGAG
gtgaggaagctgcagaagaaaagttggaagctagcagaggttggttcatgaagttgaagg
aaaaaagctgtctccataatataacaatgcaagttgaaacagcaggtgctgatggagaaa
ctgcagcaggttatccagaagatctagccaagataattatgagagtggcacactaaacaa

Exon  7 +      43223      43361   1   Internal    139    75        Good
gcaacttatagtgtttttgagtatttaggtaacaataaatttactgcctgacgtttacat
ttatttttctaaagtgtgatattataatatcatccattgctctttcttatcacttctttc
acttctttttcaaaaaatttaattagcatgaagcttgcaatcatgggcacctgaaggtag
TGGAATTATTGCTCCAGCATAAGGCATTGGTGAACACCACCGGGTATCAAAATGACTCAC
CACTTCACGATGCAGCCAAGAATGGGCATGTGGATATAGTCAAGCTGTTACTTTCCTATG
GAGCCTCCAGAAATGCTGT
gtaagtagttcaacgtaaaaattatttttaaaatggacctatattcttgaatcaaggtgt
gtgataaagcagactttaaaatagtcaagttgatggctttcttcactttcacaactaaaa
ttagatgtgatcatcacattctgcactcataatcagccttcatgccctttttatgataca

Exon  8 +      43804      43892   0    Initial     89    80        Good
gatcggataaaaaaaatgtgttacatatataccatggaatactatgcaactacaaaaaag
aatgagatcatgtttttttgtgggcacatgatggagctggaggccattatccttagtaaa
ctaacgcatgaacagaaaaccaaataccgcatgttctcacttataagtgagagctaaatg
ATGAGAATTCATGAACACAAAGAAGGGAACAACAGACACCAGAGTCTACTTGAGTGTGGA
GGATGGGAGGAGGGAGAGGAGCAGAAAAA
gtaactattaggtactaggctcaatacctgggtggtgaaataatctgtacaacacacccc
cgttacacaagtttacctatataacaaaccttcacaacttaaataaaaacctagaataaa
agtttaaaaaggggaaaaaaaataacactacgataataagtaatataggtaaaacaatat

Exon  9 +      46071      46138   0   Internal     68    58    Marginal
gaagggacagatttaatcctagggtacaagagtatggtggctgtttctaaaaatttcctt
tccagactattggtcttcatacttttttcctgtgttttttgcctcttaaaaacatgtcgt
agtcattgttgttcatctgattggctttacaaatttcctgactgttctcctccttttcag
GTTACTTTTCTTTATTCACTCTCCATCCTGCAGCCAGAGCACCTGCAGAAGAACACGAGT
CTGGCCAA
gtcatttatttgcttaaaatccttccgtggcttcctcttaatgtttttaaaataaaggtt
aaatcccaaaatatggtttataagaccctggatggtctggtgctactttcctctctgttc
tcatcggtcttcacagcttctcctttccccctttccttcaagcattttttgcaccagctt

Exon 10 +      53722      53821   2   Internal    100    53    Marginal
aaaaaaaaaaactggtgaaatctgccagtgtactgtgttgtcaaggaacagaaaaaaaat
tagagcctttgaatttttaggattcagtatatgtattagtcccttttcatactgctgtga
aacacctgagactgggtaatttataaggaaaagaggtttaattggctcatggctccccag
GCTATACAGGAAGGGCCTCAGGAAACTTACAGTCATGGTGGGAGATGAAGGGGAAGCAGG
CACATCTTACGTGGTCAGAGCAGGAGGAAGAGGCGAGGAG
gtgctgcagccttttaatttatttatttattataatttttttatttccataggtttttgg
gaacaagtggtatttggttacacaagtaagttttttagtggtgatttgtgagattgtggt
gtacccatcacccgagcagtacacactgaacccagtttgtagtcttttatccttcaccac

Exon 11 +      61664      61753   0   Internal     90    52    Marginal
taatgtgcagtccttaaagatggaacctctggaatataccttcccccagccactaccagt
ctcttcttcactcactctttttcagtcacatgggctgccttactgtgtcttgagtccacc
aaacatactctcatttcaggtgtgcagcaccacttgtttagtttttttttttttttccag
GAACTAGATGTTCCCATGGCCAGCTTCCTCACACCCTTCAGACCCAGCTCTAGCATCGTC
TTAGCAGAGAGGGCTCTGTGCCACTGCACA
gtaaatagcaacctcccagtgctgtctaacccccttcccctggtgtgttgtaccatacta
tttctcatttgatgtaatgtatttttattttcttgtgttgttttcccctctcaactagaa
tataaactgtgtgagggcaggggctggctcttctgtttactatagtagccctagcattga

Exon 12 +      64989      65121   0   Internal    133    99   Excellent
aaaaataaagagaaaaaatttatttaaaaggttctgggtgtagattcaatggaaataatt
gaaaattattagagtaaactaagtaatgaaattcaagcttatatcaagtaacagtctgtt
taatgtctttgtctagtcgtctaatgtttttaacactggtatctccttttatattaacag
ATGAACACTGGGCAGCGTAGGGATGGACCTCTTGTACTTATAGGCAGTGGGCTGTCTTCA
GAACAACAGAAAATGCTCAGTGAGCTTGCAGTAATTCTTAAGGCTAAAAAATATACTGAG
TTTGACAGTACAG
gtgaggattttgaattttgggaggtggggtagaaaaaatgttaaatagatgatccttttg
gagaactacctttgataatttacatatgttttaaccattgggagatggctgtatactttg
catcttgtaatacatctaaattttttttcagtaataaactacttatagacaacaacgtag

Exon 13 +      65684      65776   1   Internal     93   100   Excellent
tgatggccaggttagagaactagatactaaatagaagtagtcttacacttaagtgtaaaa
attgttgcctttgaagattcagatataagcttacaaaatatagatgagttataagaagca
ggccaaagaaatactttggcttgtatctttctttctcttactgctttttttgtattttag
TAACTCATGTTGTTGTTCCTGGTGATGCAGTTCAAAGTACCTTGAAGTGTATGCTTGGGA
TTCTCAATGGATGCTGGATTCTAAAATTTGAAT
gtaagtgttggatttgagagaattaagaaatgaattagactagttttgtttttcatggtt
attaatgcctgtgattaaggaacttgatgttaattttcttacctctggttagtcactgca
ttttggaaaagcttctggctgggcgtggtggctcaagcctgtaatcccagcactttggga

Exon 14 +      69741      69787   1   Terminal     47    76        Good
aataatctttccctcttccccactctcatctaagtttaaataaaattgcagctgtagaag
ttgtaaaattccccagtacctaagggaattactgaaggaatgtgccagacattttacact
ggatttatgtctgtgagatggggaagggctaaattgagtgttttttcatttttgttttag
CTGAGGAGAGATGGACCCTAGAAGACAATCATTACATCATCATTTAA
taaataacctcataatcaggctaacacattaattcttttcaaacaaattctaacaagttg
gcttctttaaatggatactgagagtactatggaattttaaaattaaatgcaacttttatt
ctatacagactttgctaattatttaaaaaaaaacattcgtataaattaagattgattagg

Exon 15 +      80214      80255   2   Internal     42    51    Marginal
tgaaatagtatcctggcttaggtttttcagaaaggagattaaaattacagttagtgttca
gtactaacttatggcttaatcctccaaagaaagagttttttaaaatattttctttatatg
ggaaaaccagttgtattacattttgttttggcataagtaagatttctgtttgcattttag
AATAATACTTAAAAACTGCCATGAAGAAGAAAAACCACTTAG
gtaaattgcttgattttaatgagagagatatagtgctcacttgatacttagtttgcttta
attcttgtgtttttgtcaggggtaaaagcatgtctacgaagaaaagtatgtgaacaggaa
gaaaagtatgaaattcctgaaggtccacgcagaagcaggctcaacagagaacagctggta

Exon 16 +      80383      80526   0    Initial    144    79        Good
ttgcattttagaataatacttaaaaactgccatgaagaagaaaaaccacttaggtaaatt
gcttgattttaatgagagagatatagtgctcacttgatacttagtttgctttaattcttg
tgtttttgtcaggggtaaaagcatgtctacgaagaaaagtatgtgaacaggaagaaaagt
ATGAAATTCCTGAAGGTCCACGCAGAAGCAGGCTCAACAGAGAACAGCTGGTATTTTTCT
TTTAATACAACTTTCATTGTTCTTATTATGACATACTATTATTATCACCATCAGGAAGAA
CTTCTGCCCTTTCAACAGCTACAG
gtgactgattaaaattttaattgtgcttatttcaagcacttgattctgaaagatgatcac
gatgagcagtaaaatccagaaggtaataatttcatactgttaatggatttttggcatctt
gaacattgccataaacctttcagaatctgaggtaaatctcagatacaggaagtagcttga

Exon 17 +      81835      82167   0   Terminal    333    98   Excellent
tacctcatgtatatgcaaattttccaaaacccaaaaaatttatgaatctgaaatgcttct
cctccaaatgtttcaggtaagggatattcaacttgtatttttattttcctcattcatata
cagtgtttttgaatacagtattttgatctgcctttaacaaatgttttctcattatttcag
TTGCCAAAGCTGTTTGATGGATGCTACTTCTATTTGTGGGGAACCTTCAAACACCATCCA
AAGGACAACCTTATTAAGCTCGTCACTGCAGGTGGGGGCCAGATCCTCAGTAGAAAGCCC
AAGCCAGACAGTGACGTGACTCAGACCATCAATACAGTCGCATACCATGCGAGACCCGAT
TCTGATCAGCGCTTCTGCACACAGTATATCATCTATGAAGATTTGTGTAATTATCACCCA
GAGAGGGTTCGGCAGGGCAAAGTCTGGAAGGCTCCTTCGAGCTGGTTTATAGACTGTGTG
ATGTCCTTTGAGTTGCTTCCTCTTGACAGCTGA
atattataccagatgaacatttcaaattgaatttgcacggtttgtgagagcccagtcatt
gtactgtttttaatgttcacatttttacaaataggtagagtcattcatatttgtctttga
atcaaaaaaaaaaaaaaagtctaatgccagattaggaattcatgttatgtttaccattta

--------------------------------------------------------------------------------