--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (96289 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        932       1129   1   Internal    198    80        Good
ctctagcagcctttccggagctcaccacctttcctcccctcacaccgccaaagccctgcc
tagcccttcaccgccgcctgcacccgcgccctcctccagccgacagccaatcacagtctt
ccacagctccgggtttacagaagtaacgctccttgggccctctggtcccgccccctccag
AACTGCTTCCCGCCCTTCGGGCTCCTTGTCCAATCATGAGCGCCCGAGTGCTCTTTGATG
CCCGTCCCCTCTACCCGCCCTGCCGAAGACCCGCCTTCTTCTCCTTAAGCCTGACGGAAT
CACCTGACTCGGAGGCGCTCCCTCAGAAGGAAGGCAAGAAGGGGCGTGTGGGTGAAGGGG
AGGGGCGCCAGAAGGAAG
gtggggatgccgggagcggggcgagcgggcgggggttgtcagtccgatctcgcgagagag
gacggaagcctgtgggagcccgtggcctttaaagtgccgttcagccttttcctccagggg
tgctttgtaaacacggctgtgctcagggctcgcgggtgaccgaaaggatcatgaactagt

Exon  2 +      15011      15069   0    Initial     59    43    Marginal
tatgtatttaaatatactttttaatcattattttggagtgtacttttacttttttttaaa
aaaaagtttattttaaaacaacctcaggcaggtccttcaggaggtattcttcaagaaggc
gttgttatcataggtgatcacggctccatgttattgcccctgaagacctagtgggacaag
ATGTGGAGGTGGAAGACAGTGACACTGATGATCGTCACCCTGTGTAGGCCTAGGCTAAT
gtgtgtatctgtgtgttagttcttaacaaaataattttaaagtaaaaaatatatatatat
atatattttttttttcttttctttttgagatggagtttcgctcttcttgcctaggctgga
gtgcagtggtgcaatcttggctcactgcaaccgccgcctcccaggttcaagcgattctcc

Exon  3 +      23850      23949   2   Internal    100    70        Good
acaagacccatcctgtactgctgaattagaatcagccaattcttcaaggagctgaggtcc
cttttggtggagaatggtatttacgcaccgtattaggccattcttgcattgctataaaga
aatacctgagactgggtaatttataaagaaaagaggtttaattggctcctggttccacag
GCTATACAAGCATGGCACTGGCATCTGCTCAGCTTCTCAGGAAGCCTCAAGGAGCATTTA
CTCATGGCAGAAGGCAAAGCAGGAGCAGGCACATAACATG
gtgagagcaggagcaggaagagagttgcagggggcacacaattttaaaaaatcagatctc
ctgagtattcattcactgttgagaggacagcactgagccatgagggatctgccccaacac
ctctcaccaggccctacctccaacattgaagattacaattcaccatgagatttggcaggg

Exon  4 +      47830      47926   0   Internal     97    99   Excellent
ctgtgattgtttgcaatctagtgtgctatctactaacaataacggattcttttatagttt
aaaaactgctatttcactgttaatggtggttttacatgttgtggaaattaatttcctaat
cattttacttatttgatcaaattgaaaatcttaactatattttaaaactttttgccacag
CGTTTTACCAACGAGGATCATTTGGCTGTCCATAAACATAAACATGAGATGACACTGAAA
TTTGGTCCAGCACGTAATGACAGTGTCATTGTGGCTG
gttagtatatgcttttattaatagcttgtatacatatttcacctggaatgtgcacaattt
ttgtgtattctctgtaaataatatagtctggtgatattccaatgacttcattatagtaaa
tgttggcaacatgtattttacccattacattttcatgtttccttctgactattcatttca

Exon  5 +      51001      51119   1   Internal    119   100   Excellent
ggaaatacgaagtacaacaaaaatttaaccaaattttgtttgttttaaaggaagaggtct
ttccaaagagagaattaacaactgactgaaccagtcctgctaatttgttaacttagtagc
tatattttagagtcttaacatatttaaatatgcatgattacttcttgacatttatttcag
ATCAGACCCCAACACCAACAAGATTCTTGAAAAACTGTGAAGAAGTGGGTTTGTTTAATG
AGTTGGCGAGTCCATTTGAGAATGAATTCAAGAAAGCTTCAGAAGATGACATTAAAAAA
gtatgttgtaaccatgaaatttaaaaagagtacttctgacagaaaagtaatcatagttta
tacttcctgctttttaaatttagacacactgtttttgaacttataaccttttccttatta
tttgaattatagatgcctctagatttatcccctcttgcaacacctatcataagaagcaaa

Exon  6 +      51252      51380   0   Internal    129    64    Marginal
ccatttgagaatgaattcaagaaagcttcagaagatgacattaaaaaagtatgttgtaac
catgaaatttaaaaagagtacttctgacagaaaagtaatcatagtttatacttcctgctt
tttaaatttagacacactgtttttgaacttataaccttttccttattatttgaattatag
ATGCCTCTAGATTTATCCCCTCTTGCAACACCTATCATAAGAAGCAAAATTGAGGAGCCT
TCTGTTGTAGAAACAACTCACCAGGATAGTCCTTTACCTCACCCAGAGTCTACTACCAGT
GATGAGAAG
gttagaaatttttagaaatacaaagtaagggggaggaacagtacccaaataaagtttact
atttaatctccataaaatgttaatgtattaaattcagtgtcagcttgcaatagttttata
tgtgaaagcctgtcaatactcagatatttcagggtaagaagactgcagcttttattgtac

Exon  7 +      57716      57802   2   Internal     87    53    Marginal
ttttgaaggataagtcaggatataagaccaaataaggatttggtatagagataaaatcag
ctggtgataaatttacaatgttctgattcttaaagtctcaaattattacaacagcagtaa
agtacaaatctcattttgaatatattctctagcaattatttttccttatgtcatgcatag
CTCGTTCGACCAGTCACCATGGTGCCTAGTGTTCCAGGAATCCCAGGTCCTTCCTCTCCC
CAACCAGTACAGTCAGAAGCAAAAATG
gtaagccagattttatttgttctgtacattgcttgaggctgttttgaattaatgttttca
ctaaagcctgcttcaaatgcacaatttagatcacatttttataaagttacggactgtttt
atactatagataaaccacaaaatttgaaaaaagaaatcttcctttagcatagtgagtagt

Exon  8 +      71759      71926   0    Initial    168    58    Marginal
atgacatgatgttacatttttaaggcctttattattattttctcaaaattcactaggaac
agcaaaatacagaatcctctagtagtactaggcaaaaggactcagggaaactacccaagg
tgctattgtttgtcttgttgatattcatgatgatctttaaggacttaaaaaaaattttta
ATGGTGTTTGCATTGCAGAGATTAAAAGCTGCTTTGACCCAGCAACATCCTCCAGTTACC
AATGGTGATACTGTCAAAGGTCATGGTAGCGGATTGGTTAGGACTCAGTCAGAGGAATCT
CGACCGCAGTCATTACAACAGCCAGCCACATCCACTACAGAAACTCCG
gtatgtgtgttgtttttattattcagcactctgtcatctttaaacagaaaagtacagtgt
aacttacggcttatttaaaaaatattactctggtcatgttgttattccaaagatgtatca
aaagcctcaggaaaaggtagctcagtatacaagtattgatacaaaaataaacataataga

Exon  9 +      76103      76309   0   Internal    207    49    Marginal
ataagtatattcaagaaggaagttaaaccacagggtgattttcatattgccccaacatac
tgatgtattcaacaagacttagaaaatacagttgctctccccctttgacaccctttactg
cctatgttaattcactcactagatacaaatataacaggctttcatctctgtttataatag
GCTTCTCCAGCTCACACAACTCCACAGACCCAAAGTACAAGTGGTCGTCGGAGAAGAGCA
GCTAACGAAGATCCTGATGAAAAAAGGAGAAAGTTTTTAGAGCGAAATAGAGCAGCAGCT
TCAAGATGCCGACAAAAAAGGAAAGTCTGGGTTCAGTCTTTAGAGAAGAAAGCTGAAGAC
TTGAGTTCATTAAATGGTCAGCTGCAG
gtatggtgcatatatgtgaattttgttttatttcttttttaataattgtgaacatagatt
ttttttttcctagttgggcctccaaacattttaggacatgatattgggtgtgtatggaat
ctatagtaaatcatagttttgtaaacctgtttgtttggatgctgagatgaaataatataa

Exon 10 +      85772      85806   2   Internal     35    83        Good
cattgtagattctcgatattagccctttgtcagataagtaggttgcgaaaattttcttcc
attttgtaggttgcctgttcactctgatggtagtttcttttgctgtgcagaagctcttta
gtttaattagatcccatttgtcaattttggcttttgttgccattgcttttggtgttttag
ACATGAAGTCTTTGCCCATGCCTATGTCCTGAATG
gtaatgcctaggttttcttctagggtttttatggttttaggtctaaccttaaagtcttta
atccatcttgagttaatttttgtataagtaaggaagggatccagtttcagctttctacat
atggctagccagttttcccagcaccatttattaaatagggaatcctttccccattgcttg

Exon 11 +      88605      88710   0   Internal    106   100   Excellent
taataaatgctaaaatataaaagctgccctgtgctgattagacatatttaatcagcatat
tttctttgtttttaatgttctgccagtgatgtccaattttatactttaatccttgcttgt
tttaaatagtaaaaaatatgtttagtctgtggtaaggtacataagttgtttcttctccag
AGTGAAGTCACCCTGCTGAGAAATGAAGTGGCACAGCTGAAACAGCTTCTTCTGGCTCAT
AAAGATTGCCCTGTAACCGCCATGCAGAAGAAATCTGGCTATCATA
gtgagtaatgttccattacctatagccttaggctacgtcagtgaaataccgtcagagtga
actgagctgctactttaaaaatggagactgtgcttctaatattcaagattaaatatcaga
atttctgtaaggttattatagaatgcagtagagaggtataattttttagaatctagagag

Exon 12 +      94535      94761   1   Terminal    227    85        Good
ttttgacctattgcaggtaaaattgcctacttcatgacctatatcaattgctgtaatacc
aacttgtctaatcagttttgtaagatactttctaactttttactctgtgtattgcctcag
catactggtgcattcttaccgattttaggaaaatgaataatttttcttttttccacccag
CTGCTGATAAAGATGATAGTTCAGAAGACATTTCAGTGCCGAGTAGTCCACATACAGAAG
CTATACAGCATAGTTCGGTCAGCACATCCAATGGAGTCAGTTCAACCTCCAAGGCAGAAG
CTGTAGCCACTTCAGTCCTCACCCAGATGGCGGACCAGAGTACAGAGCCTGCTCTTTCAC
AGATCGTTATGGCTCCTTCCTCCCAGTCACAGCCCTCAGGAAGTTGA
ttaaaaacctgcagtacaacagttttagatactcattagtgacttcaaagggaaatcaag
gaaagaccagtttccatttatgcgaaatctgtggttgtaaattttttttttttacttgaa
attaaatttggctctaaagttggtgtagcagcagttgatcagactgaaaaacggttttta

--------------------------------------------------------------------------------