--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (45044 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (33 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        303        415   0   Internal    113    90   Excellent
gcggtttcctgcgtacacagcttgtctccctaaccagagtggaggtgccttggggacaca
gccaggctcagacattcactcagctcatcatagtgccatcccatcaataaccccttctga
gtgatcctgggttagtaaaccgagtgtccctgaaattccactaccgctgattccctccag
CTGGGCAGAGGCAGCGAGCGCTGGCTGAAGCTTCCGGTGGGAAATGGGCAGTGCCTAGAA
GAGAAGGAAACGATGCATGAGAAGGTTCCAGATGTCTATGAGGAACATGACGT
gtcctgtccactactctgcttttcctcgtccgcctccccaccactggaggaaacctagaa
gctggtgcaggaaatcctcctctcaacaacccaagaacactttgcacaagaggggtgcgc
cctcggaggttgctcttccccagaggcctctcctcgctggggtttcttgaagacagatac

Exon  2 +       1329       1468   0    Initial    140    79        Good
gcgctcttgcagcctgggcttcctataaatggggtgcgggcgccggccgcgcattcccac
cgggacctgcggggctgagtgcccttctcggttgctgccgctgaggagcccgcccagcca
gccagggccgcgaggccgaggccaggccgcagcccaggagccgccccaccgcagctggcg
ATGGACCCGCCGAGGCCCGCGCTGCTGGCGCTGCTGGCGCTGCCTGCGCTGCTGCTGCTG
CTGCTGGCGGGCGCCAGGGCCGGTGAGTGCGCGGCCGCTCTGCGGGCGCAGAGGGAGCGG
GAGGGAGCCGGCGGCACGAG
gttggccggggcagcctgggcctaggccagagggagggcagccacagggtccagggcgag
tggggggattggaccagctggcggcccctgcaggctcaggatggggggcgcgggatggag
gggctgaggagggggtctccggagcctgcctccctcctgaaaggtgaaacctgtgccggt

Exon  3 +       2736       2913   2   Internal    178   100   Excellent
cttccctgtgcctcagatgagatattcaagacatgccagccaatttaaacattagcctca
gcaaaaacataatggagaagtcaaatctataaaggaaaattaagtataaagtcaattaaa
aaataatttgagttgaattaccatttttaattctctatgccactgcccctctctgcccag
AATTGGCTGTCCTTGGGAGAGCTATTTCTGCTATGTGGCTGACGTATTTCTCCCCACGTT
AGAAGATGCGACCCGATTCAAGCACCTCCGGAAGTACACATACAACTATGAGGCTGAGAG
TTCCAGTGGAGTCCCTGGGACTGCTGATTCAAGAAGTGCCACCAGGATCAACTGCAAG
gtatggaggatgcaggcaggagggacctagagcccacagctttcccccagccctgttcca
gcgggcgcccaacacgcgaccttcccggagggtgtgtactgagcaaacgcagaacatccc
agaactgttgtaatctgatcaaagcactgggactttgcctctgtttgtaagtcagccaca

Exon  4 +       4191       4336   0   Internal    146   100   Excellent
ggttggtgcacagagaacccaggaggcatgttgataaggcatgtggtgttgaggcgcagg
cagtggtgttcccagcaccattccctttggtgctctgattagagattaagccctgggctt
caggggccacctctcattcttgatagacaacctcaatgctctgctaccctgaattctcag
GTTGAGCTGGAGGTTCCCCAGCTCTGCAGCTTCATCCTGAAGACCAGCCAGTGCACCCTG
AAAGAGGTGTATGGCTTCAACCCTGAGGGCAAAGCCTTGCTGAAGAAAACCAAGAACTCT
GAGGAGTTTGCTGCAGCCATGTCCAG
gtaagtcatgttgtacatgagcacacgcatgtgtgtgtgtccgctgaggtatgaacttgt
gtgtttgcaccaggcacggatgtgactgtaagtatttgtattccgtatccatcgtggatc
agggaattactgagttttcacaatcatcaaaaagagagaagcattagttaaccttcccta

Exon  5 +       5793       5940   0   Internal    148    50    Marginal
ttatacatatttattgagaacatagtgatattttgatacatgtaatgtatggtgatcaga
tcagagtaattagcatacccatcatctcaaacatttatcatttcttcgtgttgggaactt
tctgagagagtgtaggctgtgggagataagtccgtcaccttttcctcctgatgtaaccag
AGTGGCTGCAGCCAGGTCCTCAGAAACTCAGAGAGTACCCAGTGGGAAATCCCTAAGACC
AAAGTCAGCATGGGCTTCAGCCATGGCCTGACACCATACAAAAGAATGACTGTCCAACAA
GTGTATGAAAATAAGCTCCAATTCACTG
gtagtcaagaaatgcgaattaatgtaacaacaagatatttatctgcttttacccatcata
ctgcaaaactggaaaacagtgatagcacctgttgctggcaggccagtgaggaaaagtgtg
ctgtcctgagctgctggtggaaacgagagccatcaggcaatatctactgtaatttaaaat

Exon  6 +       7163       7316   2   Internal    154   100   Excellent
gcatacttttttgaaaatgtatgtctatgtgtagctatattctatatttacaaataaatg
atgtcagaagaacaattggttaaaaaaatatgagaaaagaaacttcagtgccacccagct
tacttccagcaagttgtaatggagaaggacatttccgtgaccatcctctctctgggacag
GTATGAGCTCAAGCTGGCCATTCCAGAAGGGAAGCAGGTTTTCCTTTACCCGGAGAAAGA
TGAACCTACTTACATCCTGAACATCAAGAGGGGCATCATTTCTGCCCTCCTGGTTCCCCC
AGAGACAGAAGAAGCCAAGCAAGTGTTGTTTCTG
gtgaggatttagaaagctgatagcagtggcccttgaaactcatcttcatgtgttagagac
cagtcctaccatatacaaagcagatcactgagtcagctccatgactagttacataggaag
ccctggattggcgtgaaatactggtgcccgaggttcctcctgccccttaggctcactgac

Exon  7 +       8019       8174   0   Internal    156   100   Excellent
tcccaacttgggctggccaggcactagcaagaccacactctgcataggaagaaaaagaaa
gtccctcccaaagctagattccttctgctttttctttcacgatccccaccccatccctcc
caagtacccaaggatgttgcccgtgttgaatacatgtggttgcatcttcttcctccatag
GATACCGTGTATGGAAACTGCTCCACTCACTTTACCGTCAAGACGAGGAAGGGCAATGTG
GCAACAGAAATATCCACTGAAAGAGACCTGGGGCAGTGTGATCGCTTCAAGCCCATCCGC
ACAGGCATCAGCCCACTTGCTCTCATCAAAGGCATG
gtaagtcccatgtcagcactgtcgtgcacagcaaggagcatcctcttattaatacaattc
cagaacttttgagctagtgggcacctttgaggacagcctgccctggctgttttttataca
gactagagataggaccctgagcaggcacgggaaggtctgcccaggcttcacggcctggga

Exon  8 +       9566       9690   0   Internal    125   100   Excellent
cagctttggggatgccgacttgttgcaccccctggtctaaatgtcaagtacccagttatc
ttctttctctgagtttatctagtggtacaggactcctgctcccttctaccttgaaggtaa
atgcttttaacagaagatacagggactgatcaaaatgctcgtctccaatctctttcatag
ACCCGCCCCTTGTCAACTCTGATCAGCAGCAGCCAGTCCTGTCAGTACACACTGGACGCT
AAGAGGAAGCATGTGGCAGAAGCCATCTGCAAGGAGCAACACCTCTTCCTGCCTTTCTCC
TACAA
gtaggtcatgtgatgcacccctgatttgtcatttaatgggtcagtgtgaactgaacactt
ctcaagtgctctgttccaggcaaacctgtgcctgggagggaggaatggagagggataaaa
tgccgcccctccctgtccccctttttaagcgaacaggccatttggcagaaaagtcctagg

Exon  9 +      10373      10458   2   Internal     86    72        Good
taactagcgtgaccaggaagaggtggatgttattcattcagggccaacaatggctggatt
tacccatgctttgaaagatgggcaggacttgggtagatgcagagacagggaaaaccttca
acatggaaagaatagtatgttctggccatccgtgacatggtgtgcttccttggttaccag
GAATAAGTATGGGATGGTAGCACAAGTGACACAGACTTTGAAACTTGAAGACACACCAAA
GATCAACAGCCGCTTCTTTGGTGAAG
gtaagagtttctgtccacatagttgctggaaaatctactcaagatgtgcctatcatggct
tagccacttgctgagccctgttaaatgtctgctgactaacaagtgatacagacactggtg
ttctggctacctctagtgagaaagcaaactcatttcatgatgtcaagttgcaatggcata

Exon 10 +      11756      11975   1   Internal    220    96   Excellent
tgagtcagtgaaaacaagtcaatcacctatggcagagccagatctagcaggcattgaata
caggatagtttctttcccttttcccctgtgctgatactccacaatttccagcttccagta
gacaaagatatggttgagatgaagaaagctagagttcctttgacactttccatcttccag
GTACTAAGAAGATGGGCCTCGCATTTGAGAGCACCAAATCCACATCACCTCCAAAGCAGG
CCGAAGCTGTTTTGAAGACTCTCCAGGAACTGAAAAAACTAACCATCTCTGAGCAAAATA
TCCAGAGAGCTAATCTCTTCAATAAGCTGGTTACTGAGCTGAGAGGCCTCAGTGATGAAG
CAGTCACATCTCTCTTGCCACAGCTGATTGAGGTGTCCAG
gtatctaatggttacagctcaactttttataaaactgatggtaactgactgaactttcaa
accttggccaaatggagaatctcagggaccatttggatatcaatccagttaatcaattag
tcaatcagttcatgattgctggatagagaactatcagctgctgcgctgagttccatgaaa

Exon 11 +      12255      12366   2   Internal    112    57    Marginal
tcaatccagttaatcaattagtcaatcagttcatgattgctggatagagaactatcagct
gctgcgctgagttccatgaaacacacacgcgcatactgtgttcaaggcagctatgtattt
gtgtgttaaaacagaaggagaatagttcccacattttgatgggtaacttttaattcctag
GTCTATTGCAGGTGCTCTCCAGAAGCTTATAGGCTGGTGGAGAGAGAACTCAGACGAAAA
ATATAATATGATTTCTCTACCCTTCAAGGCACTGGCTTTAAGTGCTATGAAG
gtgagagaagggactgaggccaggaatgagacccagctaatgttggccaggcatattctg
tgtgctggccaaaggactgtgataacagtcttcttgttgctacagatccacagtcccctc
ttggaacttttctcgattgggcttcttctgtgggtaatattcctaaggaaagcatcatgg

Exon 12 +      12757      12920   0   Internal    164    95   Excellent
gatttgaatagtgaatgaggtgattaagggctctcctggcagaggacacaccatgagcaa
tattttatgtgccctgaaggtggtctgtataactttatccatgtctttcttctcagcccc
atcactttacaagccttggttcagtgtggacagcctcagtgctccactcacatcctccag
TGGCTGAAACGTGTGCATGCCAACCCCCTTCTGATAGATGTGGTCACCTACCTGGTGGCC
CTGATCCCCGAGCCCTCAGCACAGCAGCTGCGAGAGATCTTCAACATGGCGAGGGATCAG
CGCAGCCGAGCCACCTTGTATGCGCTGAGCCACGCGGTCAACAA
gtgagtttccacactgtatttctcctcctaggagcagaggaacatcttgcacctctgtgc
atctctgtattaaaactgaacccctccttccactttcaaactctgctccttactcttgtg
ttttttcttgatcatttttggggtaatgacttgaaataagaaatcagcaaacacaaattg

Exon 13 +      15259      15376   2   Internal    118    93   Excellent
gaagtcaggtaatgtgatgcctccagctatgttctttttgcttaaaattgcttcagctat
tcaggctctttttggattccatatgaattttataattattttttctaattcacaagtttg
ggttttaagacaaacctaactggggttaccaagtcctgactctcttctcttattctgtag
CTATCATAAGACAAACCCTACAGGGACCCAGGAGCTGCTGGACATTGCTAATTACCTGAT
GGAACAGATTCAAGATGACTGCACTGGGGATGAAGATTACACCTATTTGATTCTGCGG
gtaatctcagtcttttatatgacatacatcatttcagaagcacttttcctggacaccttt
tacttccctctcctgcaccctgatgggttcttgtttcttttcttcaatgcaggtcattgg
aaatatgggccaaaccatggagcagttaactccagaactcaagtcttcaatcctgaaatg

Exon 14 +      15489      15635   0   Internal    147    99   Excellent
attacctgatggaacagattcaagatgactgcactggggatgaagattacacctatttga
ttctgcgggtaatctcagtcttttatatgacatacatcatttcagaagcacttttcctgg
acaccttttacttccctctcctgcaccctgatgggttcttgtttcttttcttcaatgcag
GTCATTGGAAATATGGGCCAAACCATGGAGCAGTTAACTCCAGAACTCAAGTCTTCAATC
CTGAAATGTGTCCAAAGTACAAAGCCATCACTGATGATCCAGAAAGCTGCCATCCAGGCT
CTGCGGAAAATGGAGCCTAAAGACAAG
gtaaagtccacaagaagaggtctgaaagtgaaagtttattaacaaggatttggaaggtac
taggggaatgagactctagatttcatctactgactttattctgctgtttctttcctttcc
ttccttccttccttccttccttcctccctccctccctttcttctttccttccttccttcc

Exon 15 +      16736      16947   0   Internal    212    97   Excellent
ttacttgatagtgctctaggaaacactggcaagaagattcaataccagcatttgaagaac
gattacagagaaattagacctgtgcttaagaaagagctagcagacaatgccagtgtttgc
caggcatgttctgtgttctgaccacaggacagtgataaccatctcctcttttgactgcag
GACCAGGAGGTTCTTCTTCAGACTTTCCTTGATGATGCTTCTCCGGGAGATAAGCGACTG
GCTGCCTATCTTATGTTGATGAGGAGTCCTTCACAGGCAGATATTAACAAAATTGTCCAA
ATTCTACCATGGGAACAGAATGAGCAAGTGAAGAACTTTGTGGCTTCCCATATTGCCAAT
ATCTTGAACTCAGAAGAATTGGATATCCAAGA
gtaagtaagagctattcaccccatataccactgagggccctgagctggaattccaaccct
aggttttggcatagccactgtctgcccttgcttctgaaacaaacacttgtgcaaatgtgt
agcagatctagacccaaagacttagggtcaatgaaatcaagacattttggtagtgattgg

Exon 16 +      17272      17446   2   Internal    175    72        Good
gggtcaatgaaatcaagacattttggtagtgattggaaatccatatttacttggggtgca
agagtcaaaggataataacatggtgtgtcagctcaaaatatacttcttcttatctagtct
gaaaaagttagtgaaagaagctctgaaagaatctcaacttccaactgtcatggacttcag
AAAATTCTCTCGGAACTATCAACTCTACAAATCTGTTTCTCTTCCATCACTTGACCCAGC
CTCAGCCAAAATAGAAGGGAATCTTATATTTGATCCAAATAACTACCTTCCTAAAGAAAG
CATGCTGAAAACTACCCTCACTGCCTTTGGATTTGCTTCAGCTGACCTCATCGAG
gtaagtgtgaagagtttgaggttctctagcccattttgtacagcatcataaacagagagt
ccctgggagccaggagctacccagaggaaaactaagaaccaccaggcacttcctaccatg
attctgaggctttcttctttccctccttccccgccttcctctctccccgctaggggtcac

Exon 17 +      18310      18486   0   Internal    177   100   Excellent
ataaggtcaagattctagtgagattttaataaagcagctcctgtgaaatgctaaggtcag
ctcctggcctgtggtattcaaatacttgtttagataaatggacatcaagagtggggacta
ctaggctggcatacaacaaagaaacctgatgccattttcttgtctgattttctttctcag
ATTGGCTTGGAAGGAAAAGGCTTTGAGCCAACATTGGAAGCTCTTTTTGGGAAGCAAGGA
TTTTTCCCAGACAGTGTCAACAAAGCTTTGTACTGGGTTAATGGTCAAGTTCCTGATGGT
GTCTCTAAGGTCTTAGTGGACCACTTTGGCTATACCAAAGATGATAAACATGAGCAG
gtgtgtatttgtgaagtatcttcttaaggaaagctttgggtctcaatgcaaaaacaattc
ttttctaagcatggaagtcctcaaaatactatctaactgaagggataactatggttttta
tcaaccagacctgctggggtaagggccagtatcctctgcagttaaagatctcctgaattc

Exon 18 +      18597      18624   0    Initial     28    40        Poor
agttcctgatggtgtctctaaggtcttagtggaccactttggctataccaaagatgataa
acatgagcaggtgtgtatttgtgaagtatcttcttaaggaaagctttgggtctcaatgca
aaaacaattcttttctaagcatggaagtcctcaaaatactatctaactgaagggataact
ATGGTTTTTATCAACCAGACCTGCTGGG
gtaagggccagtatcctctgcagttaaagatctcctgaattcagtgtgcccagaaaccag
actcacaataagtactctaggataacaagagtatgaactctgggctgggtgtggtggttc
atgcctgtaatcccagcactttgggaggccaaggtgggcagatcacaaggtcaggaattt

Exon 19 +      20150      20341   0   Internal    192    90   Excellent
agaccttagttctttaatctctgcttagaggaattagcctggacttcagtgtctccctgt
tcctcacctggagcattttttaggcccatcctggctgcatcagacaggtcccacattggg
aactgaaaggtgtttgacattgctgacatctcactggccattttattactaaactctcag
GATATGGTAAATGGAATAATGCTCAGTGTTGAGAAGCTGATTAAAGATTTGAAATCCAAA
GAAGTCCCGGAAGCCAGAGCCTACCTCCGCATCTTGGGAGAGGAGCTTGGTTTTGCCAGT
CTCCATGACCTCCAGCTCCTGGGAAAGCTGCTTCTGATGGGTGCCCGCACTCTGCAGGGG
ATCCCCCAGATG
gtaagtcagcaggccccactgggggcccatgagaccagacgttggtttttttttagatcg
cccagactcccttacgatcccagctgcacaagcccgaaaagatgcttgtactttcttcag
agatggaggtttgccttgaatttcactgaagatgactcttggatcacatggaaatgttaa

Exon 20 +      21582      21749   0   Internal    168   100   Excellent
tgaaaacggtaaaaacatcagtttgatctttatttatcaaactattcagctcatcaaaat
atgctagtccttcctttccagataaagaggaattactctccaatgtatgggaggttgtaa
ttaacaaaaccgactttaaaaagacttacttttatttgctctcccttgttgggtctacag
ATTGGAGAGGTCATCAGGAAGGGCTCAAAGAATGACTTTTTTCTTCACTACATCTTCATG
GAGAATGCCTTTGAACTCCCCACTGGAGCTGGATTACAGTTGCAAATATCTTCATCTGGA
GTCATTGCTCCCGGAGCCAAGGCTGGAGTAAAACTGGAAGTAGCCAAC
gtaagattctgtttgccttttgatttcttaggttattactttcttccagggtgcatttct
tgttaaaacatatttaaaaatgtgtttccacttcaagacaaaatgcttcatcattgtaat
cacctcattatttttttatgaaaaacttcaagcttccaccagaatgcactacctcactag

Exon 21 +      22232      22443   0   Internal    212    94   Excellent
tactccaactctagagaactgagaactcgctttccttcttccaaacaaatcccagtaatg
tttccaaaggtctgagttatccaggaaatctttgcccggaggtgagaaagggtggttgat
ctgactgacaggggactgaagtatttaatgaatctgaataggttgttttctgacttatag
ATGCAGGCTGAACTGGTGGCAAAACCCTCCGTGTCTGTGGAGTTTGTGACAAATATGGGC
ATCATCATTCCGGACTTCGCTAGGAGTGGGGTCCAGATGAACACCAACTTCTTCCACGAG
TCGGGTCTGGAGGCTCATGTTGCCCTAAAAGCTGGGAAGCTGAAGTTTATCATTCCTTCC
CCAAAGAGACCAGTCAAGCTGCTCAGTGGAGG
gtaattctttcagccaagtctgcctagccagtttgaaagagagaacagagaatgtacctg
cagaattttgccaggctaaacagttgattgagatcattcaggtcctgaggaagcaggaga
ggagtagaaaggaaagattccgggttacctattttaattctagcctagacttactacata

Exon 22 +      23839      23958   0     Single    120    47    Marginal
tgcagaatggtaaggggctcagagatgatggggagaggtaggcaggggagagagcatgcc
cagctgcgaaagccatcctaaggagtttggactcttttgaaggcacaggagttgaaaagg
ggagcagaaataagataggggtgatgttttagaagaaatactctgactctagtgtggaag
ATGGGTGAGAAGGAGGCACAGCTGGACACGAAGAGACCATTGGACATCTCTTACGATCCT
ATGTGGCTAAGAGCTGATAATGGCCTGCAGTGGAGAAAAGCCAGGTATAGAAAGGAGTGA

gcagattctacaactttctaagaggcagaatcataagtactgggtgattaactgggtatg
gggacaaggcaaaagaaagaagaaaagaggaaggaggcgcccttcattttaataagaact
acagtgggagagcttctggtttcaaggaaagtgacaaattcagttttggatgtgctgtat

Exon 23 +      25369      25551   2   Internal    183    64    Marginal
tggcttgtcatgttgatgttctttctaatattatttgtttctcagtaaattaaatagtta
gagataggtgtggactgagggaagacaggaggataagggggtatttgcaccctgagaatt
tgtgatgtccattttgattcatgacttggcaataactcaggtatttttgttcttcaccag
CAACACATTACATTTGGTCTCTACCACCAAAACGGAGGTGATCCCACCTCTCATTGAGAA
CAGGCAGTCCTGGTCAGTTTGCAAGCAAGTCTTTCCTGGCCTGAATTACTGCACCTCAGG
CGCTTACTCCAACGCCAGCTCCACAGACTCCGCCTCCTACTATCCGCTGACCGGGGACAC
CAG
gttagagatgctcagtgcctgacccagcattttctcaccttccacatcatggccacctag
catggcacaggaaaaaatactctgtgttgtaagaccctgtcactagccttctgggtttgc
accatctttgggtatttaaagcagggtcctctggccaacacattgggtgtcaccttttgc

Exon 24 +      25810      25972   2   Internal    163    93   Excellent
actctgtgttgtaagaccctgtcactagccttctgggtttgcaccatctttgggtattta
aagcagggtcctctggccaacacattgggtgtcaccttttgcttccttgtgcatgggatg
ggatcacagcacagatcccaatttgctcctaattcagtgtccatgtttctgagcctccag
ACCCATCGCTATGAGCTTCCTGGAGCCCACCAATGTGCTTGAAGCCTTCACCGTACTTAG
GTGGCTCCCTGTCTTCAGCCCCCAAGTTCCAGTGCTTGTTCTCAGCTTTGCTGAAACAAC
CAGCCAACTCCTGCTCTGCTTGTCCAAAGTCTTGGGAATCCTG
gtgtctgcccttgccttgggttcttgtaggactgagggatcaaaaagatcatcttagtta
agggcaagagacaatgttaaaataaggaccatatttttgttgcatttgaggctgaattgt
tttgggaacataatcaccatccttgaaagctctaacattatgcactgtcttcattgtaat

Exon 25 +      26187      26282   1   Internal     96    81        Good
agggatcaaaaagatcatcttagttaagggcaagagacaatgttaaaataaggaccatat
ttttgttgcatttgaggctgaattgttttgggaacataatcaccatccttgaaagctcta
acattatgcactgtcttcattgtaatgtctttagattagagctggaactgaggcctacag
GAGAGATTGAGCAGTATTCTGTCAGCGCAACCTATGAGCTCCAGAGAGAGGACAGAGCCT
TGGTGGATACCCTGAAGTTTGTAACTCAAGCAGAAG
gtgagtattcaaaacacagctgcctcatctctgctcgcagtctcaggttcagaattcatg
aggagaagacatgtaatttaacctatttaacaaataggttaactgagtacccactaagcg
gcaggcctattctaagacctgggttaactgagtacccaataagcggcaggcctattctaa

Exon 26 +      28625      28812   1   Internal    188   100   Excellent
tgtatttttagtagagacggggtttcaccatgttagccagaatggtcttgatctcctgac
ctcatgatctgcccgccttggcctcccaaagtgctgggattacaggtgtgagccaccgca
cccggcccaaaacatagcttcttaccacacatctcttgattctcttatacactcgtccag
GTGCGAAGCAGACTGAGGCTACCATGACATTCAAATATAATCGGCAGAGTATGACCTTGT
CCAGTGAAGTCCAAATTCCGGATTTTGATGTTGACCTCGGAACAATCCTCAGAGTTAATG
ATGAATCTACTGAGGGCAAAACGTCTTACAGACTCACCCTGGACATTCAGAACAAGAAAA
TTACTGAG
gtcgccctcatgggccacctaaggtaaagaaggccgagggtcatctgacctgcactgcag
gcctgggtggttcttttcattattcctcttccacttcatacctgaccaagccatgttctc
ccctagtctacaatcagagtggcagagagagccctcaacaattttttttttttttgagat

Exon 27 +      30014      30271   1   Internal    258    66    Marginal
gcttctccaaatggactcatctgctacagcttatggctccacagtttccaagagggtggc
atggcattatggtatgtgtctcttcccctgtgtgagcacttccaaagtaatgcaggtgtt
gagacctgtggttacaggctgaactagtaccattcacaactatttcctacgtattttcag
ATGAAGAGAAGATTGAATTTGAATGGAACACAGGCACCAATGTAGATACCAAAAAAATGA
CTTCCAATTTCCCTGTGGATCTCTCCGATTATCCTAAGAGCTTGCATATGTATGCTAATA
GACTCCTGGATCACAGAGTCCCTCAAACAGACATGACTTTCCGGCACGTGGGTTCCAAAT
TAATAGTTGTAAGTATGAGTCTGCCAGTCAATAAATACATGGATATAAGTGCTAATTACA
TCCTCAACTCTGAGCTAG
gtgcaggaaggtttccaaagatgtataaggcatgcttccttccccccagggaattcttgg
ggagaaaaaaaaactttcacaagtgtgtagttacccagttacacaaagctgaatgtgata
catatcaaagagatgctactaagtagaacagttctttgcctagtggtatcaaaggaagct

Exon 28 +      30681      30826   0   Internal    146    93   Excellent
tatggacagtgatcagtgactggcaacgaagattcataattttctgttatttatttttaa
ctttcagtgcattgtccagcttaataattaacttgtcaaatcggtatttttgcctaatgt
tcattgctctttgaggctcatccaagcccattaccttaaaaatctcctgtcattttgtag
GCAATGAGCTCATGGCTTCAGAAGGCATCTGGGAGTCTTCCTTATACCCAGACTTTGCAA
GACCACCTCAATAGCCTGAAGGAGTTCAACCTCCAGAACATGGGATTGCCAGACTTCCAC
ATCCCAGAAAACCTCTTCTTAAAAAG
gtaaaagaagaaagcagcaaggcttcttgaaccatgcaaagtaaatgaaagattttacat
agcatgatttagacatttttttaaatttttaaaggaaataatttaagcattttaaggaga
ttaataactatagcacaaacactgtggcatctttgcattagtaaacatgagaacaccaac

Exon 29 +      31990      32114   2   Internal    125    86        Good
caaatcctccagagatctaaagatgttagagactgttaggacaccagccctccacttcaa
gtctgtgggattccatctgccatctcgagagttccaagtccctacttttaccattcccaa
gttgtatcaactgcaagtgcctctcctgggtgttctagacctctccacgaatgtctacag
CAACTTGTACAACTGGTCCGCCTCCTACAGTGGTGGCAACACCAGCACAGACCATTTCAG
CCTTCGGGCTCGTTACCACATGAAGGCTGACTCTGTGGTTGACCTGCTTTCCTACAATGT
GCAAG
gtgagctatgctcaggtaaagggtgcaccgggctagttcatggcaggctctaagaggaga
gcctcctccagggaggaaaggactttggctttctagcagataatcttccttgctacttgg
aagtcttttattttattcaacaaatagaaatatttattaaacatatcacgtgtattaaat

Exon 30 +      35928      40259   0     Single   4332    93   Excellent
cagagactcaatggtgaaattcaggctctggaactaccacaaaaagctgaagcattaaaa
ctgtttttagaggaaaccaaggccacagttgcagtgtatctggaaagcctacaggacacc
aaaataaccttaatcatcaattggttacaggaggctttaagttcagcatctttggctcac
ATGAAGGCCAAATTCCGAGAGACCCTAGAAGATACACGAGACCGAATGTATCAAATGGAC
ATTCAGCAGGAACTTCAACGATACCTGTCTCTGGTAGGCCAGGTTTATAGCACACTTGTC
ACCTACATTTCTGATTGGTGGACTCTTGCTGCTAAGAACCTTACTGACTTTGCAGAGCAA
TATTCTATCCAAGATTGGGCTAAACGTATGAAAGCATTGGTAGAGCAAGGGTTCACTGTT
CCTGAAATCAAGACCATCCTTGGGACCATGCCTGCCTTTGAAGTCAGTCTTCAGGCTCTT
CAGAAAGCTACCTTCCAGACACCTGATTTTATAGTCCCCCTAACAGATTTGAGGATTCCA
TCAGTTCAGATAAACTTCAAAGACTTAAAAAATATAAAAATCCCATCCAGGTTTTCCACA
CCAGAATTTACCATCCTTAACACCTTCCACATTCCTTCCTTTACAATTGACTTTGTAGAA
ATGAAAGTAAAGATCATCAGAACCATTGACCAGATGCTGAACAGTGAGCTGCAGTGGCCC
GTTCCAGATATATATCTCAGGGATCTGAAGGTGGAGGACATTCCTCTAGCGAGAATCACC
CTGCCAGACTTCCGTTTACCAGAAATCGCAATTCCAGAATTCATAATCCCAACTCTCAAC
CTTAATGATTTTCAAGTTCCTGACCTTCACATACCAGAATTCCAGCTTCCCCACATCTCA
CACACAATTGAAGTACCTACTTTTGGCAAGCTATACAGTATTCTGAAAATCCAATCTCCT
CTTTTCACATTAGATGCAAATGCTGACATAGGGAATGGAACCACCTCAGCAAACGAAGCA
GGTATCGCAGCTTCCATCACTGCCAAAGGAGAGTCCAAATTAGAAGTTCTCAATTTTGAT
TTTCAAGCAAATGCACAACTCTCAAACCCTAAGATTAATCCGCTGGCTCTGAAGGAGTCA
GTGAAGTTCTCCAGCAAGTACCTGAGAACGGAGCATGGGAGTGAAATGCTGTTTTTTGGA
AATGCTATTGAGGGAAAATCAAACACAGTGGCAAGTTTACACACAGAAAAAAATACACTG
GAGCTTAGTAATGGAGTGATTGTCAAGATAAACAATCAGCTTACCCTGGATAGCAACACT
AAATACTTCCACAAATTGAACATCCCCAAACTGGACTTCTCTAGTCAGGCTGACCTGCGC
AACGAGATCAAGACACTGTTGAAAGCTGGCCACATAGCATGGACTTCTTCTGGAAAAGGG
TCATGGAAATGGGCCTGCCCCAGATTCTCAGATGAGGGAACACATGAATCACAAATTAGT
TTCACCATAGAAGGACCCCTCACTTCCTTTGGACTGTCCAATAAGATCAATAGCAAACAC
CTAAGAGTAAACCAAAACTTGGTTTATGAATCTGGCTCCCTCAACTTTTCTAAACTTGAA
ATTCAATCACAAGTCGATTCCCAGCATGTGGGCCACAGTGTTCTAACTGCTAAAGGCATG
GCACTGTTTGGAGAAGGGAAGGCAGAGTTTACTGGGAGGCATGATGCTCATTTAAATGGA
AAGGTTATTGGAACTTTGAAAAATTCTCTTTTCTTTTCAGCCCAGCCATTTGAGATCACG
GCATCCACAAACAATGAAGGGAATTTGAAAGTTCGTTTTCCATTAAGGTTAACAGGGAAG
ATAGACTTCCTGAATAACTATGCACTGTTTCTGAGTCCCAGTGCCCAGCAAGCAAGTTGG
CAAGTAAGTGCTAGGTTCAATCAGTATAAGTACAACCAAAATTTCTCTGCTGGAAACAAC
GAGAACATTATGGAGGCCCATGTAGGAATAAATGGAGAAGCAAATCTGGATTTCTTAAAC
ATTCCTTTAACAATTCCTGAAATGCGTCTACCTTACACAATAATCACAACTCCTCCACTG
AAAGATTTCTCTCTATGGGAAAAAACAGGCTTGAAGGAATTCTTGAAAACGACAAAGCAA
TCATTTGATTTAAGTGTAAAAGCTCAGTATAAGAAAAACAAACACAGGCATTCCATCACA
AATCCTTTGGCTGTGCTTTGTGAGTTTATCAGTCAGAGCATCAAATCCTTTGACAGGCAT
TTTGAAAAAAACAGAAACAATGCATTAGATTTTGTCACCAAATCCTATAATGAAACAAAA
ATTAAGTTTGATAAGTACAAAGCTGAAAAATCTCACGACGAGCTCCCCAGGACCTTTCAA
ATTCCTGGATACACTGTTCCAGTTGTCAATGTTGAAGTGTCTCCATTCACCATAGAGATG
TCGGCATTCGGCTATGTGTTCCCAAAAGCAGTCAGCATGCCTAGTTTCTCCATCCTAGGT
TCTGACGTCCGTGTGCCTTCATACACATTAATCCTGCCATCATTAGAGCTGCCAGTCCTT
CATGTCCCTAGAAATCTCAAGCTTTCTCTTCCAGATTTCAAGGAATTGTGTACCATAAGC
CATATTTTTATTCCTGCCATGGGCAATATTACCTATGATTTCTCCTTTAAATCAAGTGTC
ATCACACTGAATACCAATGCTGAACTTTTTAACCAGTCAGATATTGTTGCTCATCTCCTT
TCTTCATCTTCATCTGTCATTGATGCACTGCAGTACAAATTAGAGGGCACCACAAGATTG
ACAAGAAAAAGGGGATTGAAGTTAGCCACAGCTCTGTCTCTGAGCAACAAATTTGTGGAG
GGTAGTCATAACAGTACTGTGAGCTTAACCACGAAAAATATGGAAGTGTCAGTGGCAACA
ACCACAAAAGCCCAAATTCCAATTTTGAGAATGAATTTCAAGCAAGAACTTAATGGAAAT
ACCAAGTCAAAACCTACTGTCTCTTCCTCCATGGAATTTAAGTATGATTTCAATTCTTCA
ATGCTGTACTCTACCGCTAAAGGAGCAGTTGACCACAAGCTTAGCTTGGAAAGCCTCACC
TCTTACTTTTCCATTGAGTCATCTACCAAAGGAGATGTCAAGGGTTCGGTTCTTTCTCGG
GAATATTCAGGAACTATTGCTAGTGAGGCCAACACTTACTTGAATTCCAAGAGCACACGG
TCTTCAGTGAAGCTGCAGGGCACTTCCAAAATTGATGATATCTGGAACCTTGAAGTAAAA
GAAAATTTTGCTGGAGAAGCCACACTCCAACGCATATATTCCCTCTGGGAGCACAGTACG
AAAAACCACTTACAGCTAGAGGGCCTCTTTTTCACCAACGGAGAACATACAAGCAAAGCC
ACCCTGGAACTCTCTCCATGGCAAATGTCAGCTCTTGTTCAGGTCCATGCAAGTCAGCCC
AGTTCCTTCCATGATTTCCCTGACCTTGGCCAGGAAGTGGCCCTGAATGCTAACACTAAG
AACCAGAAGATCAGATGGAAAAATGAAGTCCGGATTCATTCTGGGTCTTTCCAGAGCCAG
GTCGAGCTTTCCAATGACCAAGAAAAGGCACACCTTGACATTGCAGGATCCTTAGAAGGA
CACCTAAGGTTCCTCAAAAATATCATCCTACCAGTCTATGACAAGAGCTTATGGGATTTC
CTAAAGCTGGATGTAACCACCAGCATTGGTAGGAGACAGCATCTTCGTGTTTCAACTGCC
TTTGTGTACACCAAAAACCCCAATGGCTATTCATTCTCCATCCCTGTAAAAGTTTTGGCT
GATAAATTCATTATTCCTGGGCTGAAACTAAATGATCTAAATTCAGTTCTTGTCATGCCT
ACGTTCCATGTCCCATTTACAGATCTTCAGGTTCCATCGTGCAAACTTGACTTCAGAGAA
ATACAAATCTATAAGAAGCTGAGAACTTCATCATTTGCCCTCAACCTACCAACACTCCCC
GAGGTAAAATTCCCTGAAGTTGATGTGTTAACAAAATATTCTCAACCAGAAGACTCCTTG
ATTCCCTTTTTTGAGATAACCGTGCCTGAATCTCAGTTAACTGTGTCCCAGTTCACGCTT
CCAAAAAGTGTTTCAGATGGCATTGCTGCTTTGGATCTAAATGCAGTAGCCAACAAGATC
GCAGACTTTGAGTTGCCCACCATCATCGTGCCTGAGCAGACCATTGAGATTCCCTCCATT
AAGTTCTCTGTACCTGCTGGAATTGTCATTCCTTCCTTTCAAGCACTGACTGCACGCTTT
GAGGTAGACTCTCCCGTGTATAATGCCACTTGGAGTGCCAGTTTGAAAAACAAAGCAGAT
TATGTTGAAACAGTCCTGGATTCCACATGCAGCTCAACCGTACAGTTCCTAGAATATGAA
CTAAATGGTAAGAAATATCCTGCCTCCTCTCCTAGATACTGTATATTTTCAATGAGAGTT
ATGAGTAAATAA
ttatgtatttagttgtgagtagatgtacaattactcaatgtcacaaaattttaagtaaga
aaagagatacatgtataccctacacgtaaaaaccaaactgtagaaaatctagtgtcattc
aagacaaacagctttaaagaaaatggatttttctgtaattattttaggactaacaatgtc

Exon 31 +      40863      41005   1   Internal    143   100   Excellent
atgaagaagatggcaaatatgaaggacttcagtatggagcttttattgaattgaaacctt
ataccttttgaaaactcattgtgattttcttcatctccatacccctttcgtgatagctca
tctgtttttctgctttcagggaatgggaaggaaaagcgcacctcaatatcaaaagcccag
CGTTCACCGATCTCCATCTGCGCTACCAGAAAGACAAGAAAGGCATCTCCACCTCAGCAG
CCTCCCCAGCCGTAGGCACCGTGGGCATGGATATGGATGAAGATGACGACTTTTCTAAAT
GGAACTTCTACTACAGCCCTCAG
gtaaataccacctaatgagtgacacgcccccaagagcgagtggagaattggggcagatac
atttaattcaggaccaaatattcagagattccccaaactaggtgaaagacaggcggtaag
caacttcttctctgaggaaatattctctagaaagtattacaatgagtccttgattgattt

Exon 32 +      41940      42460   0   Internal    521    92   Excellent
aacagtagacttatttaaccataaaacaaacacatgaactgacatatgaaagataaatcc
ctttcagtatatgaaagattctctgatctttatttttaactgctaatgaagttttagtgt
actatattgtgtaattggagtaattgaaaacatgttatttttttttttctctctgtttag
TCCTCTCCAGATAAAAAACTCACCATATTCAAAACTGAGTTGAGGGTCCGGGAATCTGAT
GAGGAAACTCAGATCAAAGTTAATTGGGAAGAAGAGGCAGCTTCTGGCTTGCTAACCTCT
CTGAAAGACAACGTGCCCAAGGCCACAGGGGTCCTTTATGATTATGTCAACAAGTACCAC
TGGGAACACACAGGGCTCACCCTGAGAGAAGTGTCTTCAAAGCTGAGAAGAAATCTGCAG
AACAATGCTGAGTGGGTTTATCAAGGGGCCATTAGGCAAATTGATGATATCGACGTGAGG
TTCCAGAAAGCAGCCAGTGGCACCACTGGGACCTACCAAGAGTGGAAGGACAAGGCCCAG
AATCTGTACCAGGAACTGTTGACTCAGGAAGGCCAAGCCAGTTTCCAGGGACTCAAGGAT
AACGTGTTTGATGGCTTGGTACGAGTTACTCAAGAATTCCATATGAAAGTCAAGCATCTG
ATTGACTCACTCATTGATTTTCTGAACTTCCCCAGATTCCA
gtttccggggaaacctgggatatacactagggaggaactttgcactatgttcataaggga
ggtagggacggtactgtcccaggtatattcgaaagtccataatggttcagaaatactgtt
ttcctatttccaagacctagtgattacacttcctttcgagttaaggaaacataaactaat

Exon 33 +      44775      44889   2   Internal    115    85        Good
ttgtatttgccaagtgagaaggaaaaaatattcacaaaggcttgtacatactttgatcct
gaggaacacctctggtgtcttcatgtgccacatagtcttcctcactgactgtctgccttt
gcaaggcaaggctctccggtaggcctcgagatgaaataacaagtcctttatttcactcag
CCTGCCAGGAGTGGAGAAGGAATGGCTAGGGAGTCCTAGCCCCAGGGGCTTCATGGCAAT
ACGGACCCCAGATGTCTCCCTGGAGCTCTGCCAGGATCCATTCAAGGCCAAGAAA
gtatgattgggagaggaggggtggagatgtagattcctaacaattctgtgacccagcata
catgtatgctctttaggctcttaagcatccttatttttccaaatataatatccaacaatc
ccaagtgtagtaaaaacccaagggtttctcctgcct
--------------------------------------------------------------------------------