--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6532 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1254       1329   0    Initial     76    88        Good
accctgccactcccttcagccagtgtggcttcaggtcaagaggctgggcagggtcaaggt
ggcaacgaggggagaagccgggacacagttctccctgatttaaacccgggcagcctggag
tgcagctcatactccatgcccagaattcctgcctcgccactgtcctgctgccctccagac
ATGCTGGGGCCCTGCATGCTGCTGCTGCTGCTGCTGCTGGGCCTGAGGCTACAGCTCTCC
CTGGGCATCATCCCAG
gtaatgaggctccccgagctgcccctacacaacacacacacagggcaccccccagcccag
gctgacctgatttttgctctccccctggccagttgaggaggagaacccggacttctggaa
ccgcgaggcagccgaggccctgggtgccgccaagaagctgcagcctgcacagacagccgc

Exon  2 +       1422       1538   1   Internal    117   100   Excellent
tgccctccagacatgctggggccctgcatgctgctgctgctgctgctgctgggcctgagg
ctacagctctccctgggcatcatcccaggtaatgaggctccccgagctgcccctacacaa
cacacacacagggcaccccccagcccaggctgacctgatttttgctctccccctggccag
TTGAGGAGGAGAACCCGGACTTCTGGAACCGCGAGGCAGCCGAGGCCCTGGGTGCCGCCA
AGAAGCTGCAGCCTGCACAGACAGCCGCCAAGAACCTCATCATCTTCCTGGGCGATG
gtgagtgagccaggccttccagccctgcagccctcacagccccggcgcccggaccctcag
tggttccaggagagccctggggcccaagcctcacacatttctgttccttcagggatgggg
gtgtctacggtgacagctgccaggatcctaaaagggcagaagaaggacaaactggggcct

Exon  3 +       1651       1766   1   Internal    116   100   Excellent
gggtgccgccaagaagctgcagcctgcacagacagccgccaagaacctcatcatcttcct
gggcgatggtgagtgagccaggccttccagccctgcagccctcacagccccggcgcccgg
accctcagtggttccaggagagccctggggcccaagcctcacacatttctgttccttcag
GGATGGGGGTGTCTACGGTGACAGCTGCCAGGATCCTAAAAGGGCAGAAGAAGGACAAAC
TGGGGCCTGAGATACCCCTGGCCATGGACCGCTTCCCATATGTGGCTCTGTCCAAG
gtaagtgctgggctaccttagagtcctccaagcacagaaggggaatcctggctatggagt
gtggtaggagggagggaccctaaacagctggggctccagtaaggagttagaggcagttgg
aatcccagaggacagagatcagggtctgggtctccgtgtctgccccagagaagagctcag

Exon  4 +       1964       2138   0   Internal    175    97   Excellent
ttagagtcctccaagcacagaaggggaatcctggctatggagtgtggtaggagggaggga
ccctaaacagctggggctccagtaaggagttagaggcagttggaatcccagaggacagag
atcagggtctgggtctccgtgtctgccccagagaagagctcagagtgtctctgtccccag
ACATACAATGTAGACAAACATGTGCCAGACAGTGGAGCCACAGCCACGGCCTACCTGTGC
GGGGTCAAGGGCAACTTCCAGACCATTGGCTTGAGTGCAGCCGCCCGCTTTAACCAGTGC
AACACGACACGCGGCAACGAGGTCATCTCCGTGATGAATCGGGCCAAGAAAGCAG
gtgagctggggcccgctgctgggtcacggccaggtcacagacgttggtcacatatactga
cctctgacacccttagggaagtcagtgggagtggtaaccaccacacgagtgcagcacgcc
tcgccagccggcacctacgcccacacggtgaaccgcaactggtactcggacgccgacgtg

Exon  5 +       2215       2387   1   Internal    173   100   Excellent
caacttccagaccattggcttgagtgcagccgcccgctttaaccagtgcaacacgacacg
cggcaacgaggtcatctccgtgatgaatcgggccaagaaagcaggtgagctggggcccgc
tgctgggtcacggccaggtcacagacgttggtcacatatactgacctctgacacccttag
GGAAGTCAGTGGGAGTGGTAACCACCACACGAGTGCAGCACGCCTCGCCAGCCGGCACCT
ACGCCCACACGGTGAACCGCAACTGGTACTCGGACGCCGACGTGCCTGCCTCCGCCCGCC
AGGAGGGGTGCCAGGACATCGCTACGCAGCTCATCTCCAACATGGACATTGAC
gtgcgacccccaggccaagggctggggctgggcagagagtagcagggagggggcactagc
tcagacccaggcaaccaaaagccttatctgggccagcagggtctggaggtggggttgtgg
gcgtagaaggtgcagcccaggctgggccattcccacagccttggggaggggagtcagggg

Exon  6 +       2637       2771   0   Internal    135   100   Excellent
ggcaaccaaaagccttatctgggccagcagggtctggaggtggggttgtgggcgtagaag
gtgcagcccaggctgggccattcccacagccttggggaggggagtcaggggctgtgcatg
aggagggggcacggggccagccagggccccaaatccacctgccccatcctctgttcccag
GTGATCCTAGGTGGAGGCCGAAAGTACATGTTTCGCATGGGAACCCCAGACCCTGAGTAC
CCAGATGACTACAGCCAAGGTGGGACCAGGCTGGACGGGAAGAATCTGGTGCAGGAATGG
CTGGCGAAGCGCCAG
gtgatgggggctggcgggtgcagggggcacagcagggggagggcagaggtgtggggctca
gggctgtgggctgaggcctggctctctccctccccacagggtgcccggtatgtgtggaac
cgcactgagctcatgcaggcttccctggacccgtctgtgacccatctcatgggtaatgac

Exon  7 +       2871       2943   0   Internal     73    65    Marginal
gagtacccagatgactacagccaaggtgggaccaggctggacgggaagaatctggtgcag
gaatggctggcgaagcgccaggtgatgggggctggcgggtgcagggggcacagcaggggg
agggcagaggtgtggggctcagggctgtgggctgaggcctggctctctccctccccacag
GGTGCCCGGTATGTGTGGAACCGCACTGAGCTCATGCAGGCTTCCCTGGACCCGTCTGTG
ACCCATCTCATGG
gtaatgacccccttcctgccctggcatccctcagatggcctcagatggcaccttctgagc
ctgtgtgcacatccgccagcacccgcccacccccagcctgccagtcaccacaggacccct
tgtcccacaggtctctttgagcctggagacatgaaatacgagatccaccgagactccaca

Exon  8 +       3057       3208   2   Internal    152   100   Excellent
cggtatgtgtggaaccgcactgagctcatgcaggcttccctggacccgtctgtgacccat
ctcatgggtaatgacccccttcctgccctggcatccctcagatggcctcagatggcacct
tctgagcctgtgtgcacatccgccagcacccgcccacccccagcctgccagtcaccacag
GACCCCTTGTCCCACAGGTCTCTTTGAGCCTGGAGACATGAAATACGAGATCCACCGAGA
CTCCACACTGGACCCCTCCCTGATGGAGATGACAGAGGCTGCCCTGCGCCTGCTGAGCAG
GAACCCCCGCGGCTTCTTCCTCTTCGTGGAGG
gtgcgtggtggcccctggggagtgggggttgggggttggagcagggcaggctcagcatct
cccccctctggccttcctgcaggtggtcgcatcgaccatggtcatcatgaaagcagggct
taccgggcactgactgagacgatcatgttcgacgacgccattgagagggcgggccagctc

Exon  9 +       3291       3482   1   Internal    192   100   Excellent
ccgagactccacactggacccctccctgatggagatgacagaggctgccctgcgcctgct
gagcaggaacccccgcggcttcttcctcttcgtggagggtgcgtggtggcccctggggag
tgggggttgggggttggagcagggcaggctcagcatctcccccctctggccttcctgcag
GTGGTCGCATCGACCATGGTCATCATGAAAGCAGGGCTTACCGGGCACTGACTGAGACGA
TCATGTTCGACGACGCCATTGAGAGGGCGGGCCAGCTCACCAGCGAGGAGGACACGCTGA
GCCTCGTCACTGCCGACCACTCCCACGTCTTCTCCTTCGGAGGCTACCCCCTGCGAGGGA
GCTCCATCTTCG
gtaggcctggggagagtggcaggtgctgctgcagcaattaagtgggtgaaatctgagcct
cagtctcctcctctgtcaaatgggagtaatgctggcaccagccctgtagggtctcctgag
gactaagcccctgaccaggcaaaacgtggcggtgcctagcacgtgggagacactccacag

Exon 10 +       3702       3818   1   Internal    117   100   Excellent
aagtgggtgaaatctgagcctcagtctcctcctctgtcaaatgggagtaatgctggcacc
agccctgtagggtctcctgaggactaagcccctgaccaggcaaaacgtggcggtgcctag
cacgtgggagacactccacagctgtgttcagctcaaccacagggacccctctctctgcag
GGCTGGCCCCTGGCAAGGCCCGGGACAGGAAGGCCTACACGGTCCTCCTATACGGAAACG
GTCCAGGCTATGTGCTCAAGGACGGCGCCCGGCCGGATGTTACCGAGAGCGAGAGCG
gtgagtgccgcggggtggccccctgagggggaccagggtgccaaggatggggggctggcg
ggaaggggtcacctcctgtctgcctggaactgaatgaaccctcctaccggaactgaaccc
tccaaccagggagccccgagtatcggcagcagtcagcagtgcccctggacgaagagaccc

Exon 11 +       3948       4246   1   Terminal    299    84        Good
gctatgtgctcaaggacggcgcccggccggatgttaccgagagcgagagcggtgagtgcc
gcggggtggccccctgagggggaccagggtgccaaggatggggggctggcgggaaggggt
cacctcctgtctgcctggaactgaatgaaccctcctaccggaactgaaccctccaaccag
GGAGCCCCGAGTATCGGCAGCAGTCAGCAGTGCCCCTGGACGAAGAGACCCACGCAGGCG
AGGACGTGGCGGTGTTCGCGCGCGGCCCGCAGGCGCACCTGGTTCACGGCGTGCAGGAGC
AGACCTTCATAGCGCACGTCATGGCCTTCGCCGCCTGCCTGGAGCCCTACACCGCCTGCG
ACCTGGCGCCCCCCGCCGGCACCACCGACGCCGCGCACCCGGGGCGGTCCGTGGTCCCCG
CGTTGCTTCCTCTGCTGGCCGGGACCCTGCTGCTGCTGGAGACGGCCACTGCTCCCTGA
gtgtcccgtccctggggctcctgcttccccatcccggagttctcctgctccccacctcct
gtcgtcctgcctggcctccagcccgagtcgtcatccccggagtccctatacagaggtcct
gccatggaaccttcccctccccgtgcgctctggggactgagcccatgacaccaaacctgc

--------------------------------------------------------------------------------