--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (147902 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (29 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1138       1475   0    Initial    338    59    Marginal
ctggaccgggctgggccaaccgggagtcagctcgaactcacctgcttggcaggtgcgcgc
ttcccgaggcgtgacaagggagcgccggcgcggtgggtggggggcagagaatgtgaagct
ccagacgcatggcacccgccgccaagtcgccgcggtggctgccgggatgcgccgcagcga
ATGGTCGCGCCGGGCGCCGCTCTGAGTGACCTTTCACCCGCGCCCAGCGGTTCCGGGCGG
CAGCACAAGGCGGTAGCCATGGCGGAGGCGGCGGCTGCAGCGGGTGGGACTGGCTTGGGC
GCGGGCGCGAGCTACGGGTCTGCAGCGGACCGGGACCGGGACCCGGACCCGGACCGCGCC
GGGCGGAGGCTGCGGGTTCTCTCTGGCCATCTGCTGGGCCGGCCCCGGGAGGCTCTGAGT
ACCAATGAGTGCAAAGCGCGGAGAGCCGCGTCGGCGGCCACGGCAGCGCCCACGGCCACT
CCCGCCGCGCAGGAGTCGGGCACCATCCCAAAGAAGCG
gtgagtagcggtatgtggaaggagttagcgtcgagggaccaggccgggcctgtgctgcag
gagggcacaggcgaggtgggaagggaagtgacacgggtgggcggaaggcatcccggtccc
tgaaagtagggacccacctctctttcgagagagtggactagaccctggattctgtcagga

Exon  2 +      19143      19263   2   Internal    121    77        Good
aggagtggggctttcaagcataattagaaagccatgtgaaaagagtaaagttccccagtc
acaacttagtggctgggagaagtatttagtgactgcctgtcttaggacccctcagataat
gacagatctggaggacagttgtccgggacagggagagtaagactgagaaggccacaccag
TGTCCAGGAGACAGTTAACCTCCTGGCCCTCAATGGTCAAGCATACCCGGGGCTCTGTGA
GGGTGACGGCATGGGCTGGCGCTTACCCCAGGCACCCTCAGTCCTGCTGCTGGATCATCT
G
gttagtggcttctgactcagagatccttcatcccctggggcagtgggccttccagtgatt
cccttgacataaggggcatggacgagggggtagcttatttctattcggacaatctttttt
aaagtgtccttgtaggccgcactggaagcaagccctattaggcattcaacttgcccagcc

Exon  3 +      21355      21492   0     Single    138    46    Marginal
cacggattccaaggaatggaatcttgggccatgtggtgagtgttatagctctattagaag
ccatgggtcatggaacagaaccgtggaacccagcgactagtgttcagcttgattaggatg
aacttgggcacttagctgtgcaggaacaatggcaagcctttagcccgatcgggagtggca
ATGGGTGCCTCGCTGGATCAGGAGCACAGTGGACACCCTGCTGGATCTGGAGGGGTGGAA
GTCAGCATCAGCGGCGGGTCTGCGATGGCGGCAAACAACAGTGGTGGATGGCAAGTGAAA
GCACAGCTGGAGCCATAA
caaacacagaccagaagagtatgcagttgcaagatttaatagagtgaaaacggagctccc
atacaatgggagggaacccaaagggggttgcccaacaattacggtttacaacaagaatac
tgtgtacattaagccggtatggatttcagtcttggtatttttagggtcatgccaagggta

Exon  4 +      25535      25565   1   Internal     31    92   Excellent
aattggattcttttatttgaatcttatggaaagttgatgattctttaatcattcttcatt
ttagtgcttgcagtactttggggttattctgaatggcagaattcattacactatcggaag
tatagggaatttggcttctgacacaaacatatcccttgatttttaaatgttttccttcag
CTGAAGTGCAGAAGAATTACTACAACACAGG
gtgagcatccttaatttgaaaatctaaaatccacaatgttccaacattggaaactttttg
aacactgtcatgagatagtgattcctttgcttcctgatagttcagtgtatgcaaactctg
tttcatgcacaaaaccattaaaaatattgtataaaattaccttcaggctatgtgataaga

Exon  5 +      28695      28784   2   Internal     90   100   Excellent
ttctatattcagaaatattagtatatggacattttaatgtgtgctaattttatttaacct
tatacaatatttgtgggcataaggtattttagatgattgtgagttaataatcaatgatat
actgtacagttttaagatgtttagcattggtctcacttatatatattttcttctcactag
GCAAGAAGTTATGAAATGGAATGGATGGGGATATAATGATTCTAAATTCATCTTCAATAA
GAAGGGCCAAATTGAATTGACTGGGAAAAG
gtaaccctggtttatttcttcttttgttcctcctttaattctttctttctatgaaaaatt
ttaaacacacatgaaaatataatgattcctccttgagtttaaacattatcaacattttgc
cataactgctttttgtctcctggtaatatttcaaattctgatgttgtcatgtcacctcta

Exon  6 +      40117      40238   1   Terminal    122    51    Marginal
gcaggagaacagggcgtaatttcagtccttatctcaactgcatgagacagacacttccag
agcagctgtttatagacgtccccccaggaatgcattccctccccagggtattaattatta
atattccttgctgggaaaataattcagcgatatctctcctgctttcacgtccttttatag
GCTCTCTGCAAGAAGAAAAATATGGCTCTATTGTGCCTGACCCCGCAGGCAGTCAGACCT
TTGGTTGTGTTCCCTTGTTCCTTAAAATTGCTGTTATTCTGTTCGTTTTCAAGGTGCTCT
GA
tttcatattgttcaaacacacatgttttacagtcaatttgtacaatagtggtcctgaggt
gacctacattctcagcttatgaagataacaggattaagagattaaaggcaggcataagaa
attataagagtattaattttgggaactgataaatgaccatgaaatcttcacaatttgtgt

Exon  7 +      41199      41283   1   Internal     85    78        Good
gatataaagactttattttagtgatagaaggtagttttaaattttatacatgatagtaac
actaactctgtatctgtagtttcaagtatcttgaaggtggtcacctttttattttatggg
aatacctgagactgggtaattaataaagaatagaggtttatttggctcatggttctgtag
GCTGTGCAAGAAACATGGCATCAGGGTCTGCTTCTGGTGAGGACCTCAAGCTGCTTCCAG
TCCTGCAGAAGGGGAAGGGGAGCTG
gtatgtgctgagatcacatggtgaaactgaaagcaagagagagatggtagggaggtgcca
ggctctttttaaacaaccagctcttgagggaactaacaactcactcacacttctctccct
tcccccagggcattaatctattcataaagatatacgtccatgacccaaccacctcccact

Exon  8 +      42753      42843   2   Internal     91    95   Excellent
tgtctatactgcctttagatagctgggttttgtttgttttgttttcgttcagagtttata
gttacatgtgaaagtgttggtttgatagtagctgcttgaccatcactggaagcagaattt
aagctttaaatttaaatgaagatactttgctctaatatttttactttctttgtaccttag
GTACCCTCTTAGTGGCATGGGTTTACCAACATTTAAAGAATGGATCCAAAATACCCTTGG
AGTAAATGTGGAGCATAAAACTACCTCTAAA
gtaagcaaacaaaaattattactaactcatttaactgtgtttttaaaacccaaattaatt
tgatttatctttgtaattcattatattggatttactgcaactgtcatgttttttgttata
aagcctattaattatattggccttgttagactgttagcggcagttattcattgtcacaga

Exon  9 +      45190      45310   0   Internal    121    99   Excellent
tttgtaatttgttactctcataaagctgatttctatatatgttgtgttgtattttcctat
gcttcagccttactttgaatgtttaaaaaaaagtctacattttatagtcattctctctaa
ctgaagtacccaaaattcgttgtctaaaaataagtcaaagaaatcaattttattttctag
GCATCCTTAAATCCTAGTGATACACCTCCTTCTGTTGTAAATGAAGATTTTCTTCATGAC
CTTAAAGAAACTAATATTTCATATTCACAAGAGGCAGATGATCGAGTATTTAGAGCTCAT
G
gtaagttactttatattagccctatttatttttaacaaaaaaattctatattttaagctg
tttttgtgtttttcttttttttaaccacaaaacaggtcattgtcttcatgagatattttt
gctcagggaaggaatgtttgagcgaattcctgatatagttttatggccaagtaagttttc

Exon 10 +      49391      49462   1   Internal     72    64    Marginal
ttatttcaaaatgaaaagttaaaaaggtaaagtgttttagtactcaattaactcattgtg
ttaatgagcaaatgaatgaaggaaaagtttagataaagaatttcgtaggttcttatttgc
caaggttatcagattttatttatgcctctgtaattaatttattttcccttttttcaacag
CATGCCATGATGATGTAGTTAAGATTGTGAATCTAGCTTGCAAATATAATCTTTGTATCA
TACCAATTGGTG
gtaggtattgtgccttttgaattttaatatgtaaatttgttctatttaaaatatttgtat
tttaaatatttgcgtcaccctactgaaaacaaacattattgtaattgtgatgtggttatt
ctcaaaaattggtcaatgatgctcatttttgttctaagtaggattccttaaactgtttga

Exon 11 +      53100      53235   2   Terminal    136    60    Marginal
gtaacataaaactaaaagtgcattcacatacatcatcttatttaatgtttttcacaacgc
tgtgaattaagcagtgcagttatttgtatgtgttcagatttggaatgtaggcagcaactg
ctatttttgtattgtattttgtattgtctgttgtgctctttcctttttattattaagtag
ATTTATCTATGTTAGTTATTGCCGTGAAATTGAGCATATGAAAGTAGAAAGAAAGCTTCC
CTGGGATCCAGAAGAAGGTTCTATATGTTACCCAATTGCTCAGCCAGATAGAAAGGGGAA
AGAAGTCTGCTCTTAA
tagtagaaagtaattcatgaaaattcatatatgtatataaaagttaggtcaaataagaat
gccaaataacattttttattggcagtcatacgtttggtaagttgagccagatgaaattta
gttccttcttttgagcccgaggcagggatttgctttgttttgtacatggggtctctggcc

Exon 12 +      53972      54052   0   Internal     81   100   Excellent
tatgttgtcatgttgtatagtctgggataagtggacttggtttccagtgtgggtggttga
ggggaacccttcttgcttaatcactgtcttaccacttgttgctttgaattaggaagttat
atttcctgagaaaatattagtagttcctggagatcagatttctttcttcctttgcaacag
AATCGAATTCTCTGGGTTGATGAGAACAATTTGACAGCTCATGTAGAGGCTGGCATAACA
GGACAAGAGTTGGAAAGACAG
gtatgttatttatttttcttatttttttaaattaacttattctaatatcaattctgatgt
tatttctttaatgaaagttttcaaaactgtatcccctctatgaatgaaataccttttatg
atacattcattcactcaaagaatttgtttagtttctattatgggtcaagcattgagctag

Exon 13 +      65535      65618   0    Initial     84    71        Good
cacgtaattggaagtaaaacactcctcagcaaatgcaaaagaacagaaatcataacaaac
aatctctcagaccacagtgcaatcaaattagaactcaggaataagaaactcactcaaaac
cgcacaactacttgaaaactgaacaacctgctcttgaatgactactgggtagataacgaa
ATGAAGGCAGAAATAAAGATGTTCTTTGAAACCAGTGAGAACGAAGACACAATGTACCAG
AATCTCTGGGACACATTTAAAGCA
gtgtgtagagggaaatttataacactaaatgcccacaagagaaagcagtgaggatctaaa
attgacaccctaacatcaaaattaaaagaactagagaagcaacagcaaattcaaacacta
gcagaagacatgaaataactaagatcagagcagaactgaaggagatagagacacaagaaa

Exon 14 +      66518      66928   0     Single    411    51    Marginal
tgaacatcgatgcgaaaatccttaataaaatactggcaaaccgaacgaatccagcagcac
atcaaaaagcttatccaccacaagcaagttggcttcatacctgggatgcaaggctggttc
aacatatgcaaataaatcaatgtaatccatcacataaacagaaccaaggacacaaaccac
ATGATAATCTCAATAGATGCAGAAAAGGCCTTCAATAAAATTCAACACCCCTTCATGCTA
AAAACTCTCAATAAACTAGGTATCGATGGAACGTATCTCAAAATATTAAGAGCTATTTAT
GACAAACCCACAGCCAATATCATACCGAATGGGCAAAAGCTGGAAGCATTCTCTTTGAAA
ACTGGCACAAGACAAGGATCTCCTCTCTCACCACTCCTATTCAACATGGTATTGGAAGTT
CTGGCCAGGGCAATCAGGCAAGAGAAAGAAATAAAGCGTATTCAAATAGGAAGAGAGGAA
GTCAAATTGTCTCTGTTTGCAGATGACATGATTGTATATTTAGAAAACCCCATCGTCTCA
GCCCAAAATCTCCTTAAGCTGATAAGCAACTTCCACAAAGTCTCAGGATAG
ggtgcaaaaatcacaagcattcctatacaccaataacagagagccaaatcatgagtgaac
tcctattcacaattgctactaagagaataaaatacctaggaatccaacttacaagggatg
tgaaggacctcttcaaggagaactacaaactgctgctcaaggaaataagagagaacacaa

Exon 15 +      67235      67383   1   Terminal    149    99   Excellent
acctcttcaaggagaactacaaactgctgctcaaggaaataagagagaacacaaacaaat
ggaaaaacattccatgctcatggataggaagaatcaatactatgaaaatggccatactgc
ccaaagtaatttgtagatgcaatgctattcccatcaagctaccacttactttcttcacag
AATTGGAAAAAACTACTTTAAACTTCATATGGAACAAAAAAAGAGCCCACGTAGCCAAGA
CAATCCTGGACAAGAAGAACAAAGCTGGAGGCATCATGCTACCTGACTTCAAACTATACT
ACAAGGCCACAGTAACCAAAACAGCATGA
tactggtaccaaaacagatgtataggccaatggaaaagaacggaggcctcagaaataaca
ccacacatctacaaccatctaatctttcacaaacctgatacaagccatgggggaaagatt
ccctatttaatcaatggtgttgggaaaactggctagccatatgcagaaaactgaaactgg

Exon 16 +      68446      68577   0    Initial    132    81        Good
agcctacgataaagacacatgcacatgtatgtttactgcagcactattcacaatagcaaa
gacttggaaccaacccaaatgtccatcaatgatagactggattaagaaaatgtggcacat
atacaccatggaatactatgcagccataaaaaaggatgagttcatgtcctttgtggggac
ATGGATAAAGCTGGAAACCATCATTCTCAGCAAACTATCACAAGATCAGAAAACAAAACA
CCACATGTTCTCACTCATAAGTGGGAGTTGAACAATGAGTACACATGGATACAGGGAGAG
GAACATCACACA
gtggggcctggggcgcggtgggaggctaggggagggataacattaggagaaatacctcat
gtagatgatggattgatgggtgcagcaaaccaccatggcatgtgtatacctatgtaacaa
aactgcacgttctgcacatgtaccccagaacttaaagtataatgataaaaaaaaatgcaa

Exon 17 +      70319      70444   0   Internal    126   100   Excellent
taaaaaaatttttaggactagtgtgataaaagtatcttttttttttttttttgctatgta
ggaattaataaattcaaatatcaatgacatggaaattttaaagtgggaggagttaatgtg
ttgagtgctgtacgtaatgggaccattttcactgtaaaatgttaaatttttgtttttcag
CTTAAAGAAAGTGGTTATTGTACAGGTCATGAACCAGATTCCCTGGAGTTCAGTACTGTA
GGAGGATGGGTATCTACTCGCGCATCAGGCATGAAGAAGAATATCTATGGCAATATCGAG
GACCTG
gtaaatatttttctagttattatgtaataattgattagtatatagatattattataaaat
gattagaagcctttaaaaattaagagttgggcctgggcgcggtggccaatgcctgtaatc
ccagcactttgggaggccgaggcgggcggatcatgaggtcaggagatcgagaccatcctg

Exon 18 +      74380      74417   1   Internal     38    60    Marginal
tcagggagctcctaggtctgggctccttgaagggccacagctcttctctccttctctttc
ctctctttccctctcgttgccctccatggggcaaacaaggggtgtgtttcagccctgttt
gtgttacagccctttcagctccgccatttagcgggtcctgagtttttgtcccacatccag
GAAGAATGAGGTATGCGGACAAGTGGAGGGTGAGCAAG
gtgaaggagtgctttattgagtgacaaaacagctcagaggagactcatattgggtagctc
ctttccgcaggtaggccatcctgatgagcatccagctctcagcagagagcccacagaggg
tagttcctctccacaggcagggcatcctgatgagtgtttagccctcaggagagaggagac

Exon 19 +      76806      76950   0    Initial    145    69    Marginal
tcttagaatggtttttccctcttttaaggttatatacaaatttaactttagtctaaaaat
tactaaaagatactagaattcttaaaagcatcacaatttattacttaacccaatacttta
aaagtaggttttacataaatatatataaatgtctgtacatagacacacattcactaacag
ATGTCTAGAATTTACATCGTGTATTGTATTAAACAGGTGGTTCATATAAAAATGGTAACA
CCTAGAGGTATAATAGAAAAAAGCTGTCAAGGACCTCGTATGTCAACAGGCCCTGATATC
CATCACTTCATCATGGGATCTGAAG
gtaaatataactgtaaatttattaagaaaaaatacaggttagtcatgcagttttgtgaaa
atctttatattgtgacatcagatctttgaaagacatgttttatatgtttaaggaattttt
taaatttttatcattttaagactataaagttttattatgagaacatctgattaaacttcc

Exon 20 +      78566      78675   0    Initial    110    53    Marginal
aatgcagaagaaatatgaacaagatgaagttgataggtgcttacaaaggcttccccaggg
aggccatacctaaagtggtctttgaggttgataagaagaaaataattccaggtcaagttg
agggaagacagaagaggggagttgccctgcagagtgaccatcatgttggtgggcttagaa
ATGAGAAAGGGCCATGTCTGCCTCATTATGAGGCTGCTGGTTTTTCAGTATGACTGGAAT
GTAAGGTTTAATTGTGGAGTAGAACAGGCAGCAGGTCTAGGAGCAGAATG
gtaagggctacagggtagttcgagagataatttggtcttttcatgccttttaaaatgatt
tgaacttttatctaaaagactgggctacctccgtaggtagtcactaactgtatgaattta
aggaagggacaaagttattatagtaaagtaagcaaagaactataagagattgggctgggc

Exon 21 +      88805      89015   0    Initial    211    41    Marginal
ccatttgacccagcaatcccattactgggtatatacccaaaggattataaatcgtgctgc
tataaagacacatgcacacgtatgtttagtgcagcactattcacaatagcaaagacttgg
aaccaacccaaatgtccatcaatgatagactggattaagaaaatgtggcacatatacacc
ATGGAATACTATGCAGCCATAAAAAATGATGAGTTCATGTCCTTTGTAGGGACATGGATG
AAGCTAGAAACCATCATTCTCAGCAAACTATGGCAAGGACAAAAAAGCCAAACACCACAT
GTTCTCACTCATAGGTGGGAGTTGAACAATGAGAACACTTGGACACAGGAAGGGGAACAT
CATACACTGGGGCCTGTTGTGGCGGGGGGAA
gtggggagggatagcattaggagatatacctaatgtaaatgatgagttaatgggtgcagc
acaccaacatggcacacgtatacatatataacaaacctgcacgttgtgcacatgtaccct
agaacttaaagtataataaaagtatatatatataaatttaaaaatttaaaaataaataaa

Exon 22 +      90485      90612   1   Internal    128    60    Marginal
tgtaaaatttgcttaattttataattttttctagaatgacttgagtagccattattcccc
aggtagacttgataaatttaaatgtgcataataaattgaattaatagattaaatagattt
aaatatgatttagaaaattgtcatgtgatgtactggattattcccccttctttttttcag
GAACTCTTGGTGTAATAACAGAAGCTACAATAAAAATCAGACCAGTCCCTGAATACCAAA
AGTATGGCTCAGTAGCTTTCCCTAATTTTGAACAAGGAGTAGCCTGTTTAAGAGAAATTG
CAAAACAG
gtaaaagaaaaaatatatatatatacatacatacatatatgtttatgtatttatattttt
caaattctactacatagttgattgtgatatgttacaactaatcttcatttttagttgtat
tatatttgtggtttttacccagttctatatgaaaaggtagtgttgtacagtcatccttta

Exon 23 +     101574     101629   0   Internal     56    82        Good
tagaagtcattgatatttgtcttcataaaagtatatgaaaagttaactttttttcctctg
taaatccttaggaactaagctcttgatctcttaaatatagaaagataatattcacattct
acctgtctagcttcttactgtattaaatttgtatcacttttttttttctttttaaaacag
AGATGTGCTCCGGCATCTATTCGCCTCATGGACAACAAGCAGTTTCAGTTTGGTAA
gtaaggagtggtaattttaaaatgtcatttagccacagaaatttatgaaacatcagtagg
aagagtacggagtgcagaggtagaaagaacgtcagtcttgcctttcaggaagatgtcagt
ctaatgaagatagacaattacataaatgagtgagggtagcagtgttggagggcctgtgaa

Exon 24 +     102150     102396   2   Terminal    247    45    Marginal
accagacttcttcacttggcagcaaaaatgtgaaggtgtgaaactcaatgatgtgtgtta
ggggacttcaaattgttctatgtggctcaaatagagggtggggttagagttgttacatga
gataaagttggttgggtgggctagggctttgcaggatagatttggattttgtcttgtcag
CAGTGGGATTTCTTTGAAGAATAAAATCAATCAACTTTACATCTTAGCTCATTCTGGCAG
CATTGTGCAGGATAGATTAGAAGGGTACATGCATGGAGGAGAGACACTAGGAGATGAAAC
AGCTCAAGAAGCAAAGTTTGAGGGCTTTGAGCATGGCAGCAGCAATGGAGATAGAGAACG
GATGATAGATTTTCAGAAAATCAGTTTGCTAACTGGATGTGGAAGGCTAAATAAAAGGAG
GAGTTGA
agacaacacctagactgatttgattgggtagattaaataacatagaagaatgggtggtgg
tcttgggaaaaagatatgataatgggttgtagttatattgtgaaatttactttgggattt
aagtttatagaatttaaataccctcaaaacaattcctaaaatcatgagagtgatcgttca

Exon 25 +     106135     106191   1   Internal     57    54    Marginal
atatcgtaatataaatatttatgtaaataacacgggaagattttaaaaattaaagttgtg
aaaacttttactttcttttaggattctaagttggagtagcttcttgatcttctgaaaaac
atagactaacctattaatataaacttttttctcttcttaggtcatgctcttaaacctcag
GTTTCCTCTATTTTTACATCATTTTTGGACGGATTAAAAAAGTTTTATATTACAAAG
gtaagaatttttataaaatgctaaaattgtaaatgcttaagatatctgttttctgctttc
ttcccacatgcacctattgtaagggtgtttttccatgttgctatgtacatttcagaatta
cagtttttcatgttggaataaatattaagtaaatcaggcagtcaatttcagaaaatttta

Exon 26 +     108044     108168   0   Internal    125   100   Excellent
aatgacctaaataggtttattaaacattcttagtgattgacatgtaaagttccaaagctc
aatttttaagaaatcagtgtatttgagcccagatcagaaggaaaagagcaaaatgtattt
tgatttattgttttgtaggataagacttatctgtaataataaatttttttttttttgtag
TTTAAAGGATTTGACCCAAATCAGCTAAGTGTAGCCACATTACTGTTTGAGGGGGATCGT
GAGAAGGTTCTTCAACATGAAAAACAAGTGTATGATATTGCTGCAAAATTTGGGTATGGC
TTCAA
gttcataatgccaagagaaagagttaaaagctaagattctaatatcaccaagcaattatt
aaagtactaggcattaatgtctccaaacagactgcatgtctcaaagtagttattaatttc
agtttagtgttaaatttgtggtaatttatgatagtaaacttaaaatattgttttggttta

Exon 27 +     115099     115114   2   Terminal     16    80        Good
aattttgaaccttatacacaacaattgttgtaagcttatgtacaacatgtttttctctaa
aaaaggctgaattaatatgttctcattttagcaaaaatttaatcccagctaaaatctaaa
tgttaaattgcagtgaatttgaagcatatagtcctcctcttttgtcccctgcccccacag
TGATGATGATAAGTAA
aagtatatttattgcctgttcagcattttagaaattttgactaagagatgtactgatcat
gaaaggtaatagatgattgtagatcttgtaaataatatctacaattatcaattgtcaata
tcatagtttcttcccatagtaagcattttgaatatacataaaatgttgtttgttaggcat

Exon 28 +     129695     129794   2   Internal    100   100   Excellent
gttttggcggacaactctaaagcaagccaatgtgtattccttccatggagtagaggctgg
gaagaaactgagattatatcttaaactaatcatttgggtcgtcttgactttcagtttcta
gatgttaaatctgatttcacttaacttaaagcccctgtggggattttgtttgttttttag
GGTGACGCAGACTTACGATGCAGGTGCTTGTATCTACTTCTATTTTGCCTTTAACTACAG
GGGAATTAGTGACCCACTGACCGTATTTGAACAAACTGAG
gtaattttgcatacctgcatatagcttttacagctgttgattaatttcaataaattttac
tgtcaatttatgaattttaagttgagtctctttaatcacacatggtttgcctagctgtta
gcccttagaaatgaaaagcatatttgtttccctggcttatgtactgaattgtgagtctaa

Exon 29 +     146500     146621   1   Terminal    122    92   Excellent
atacattgggcttaatgagcttgatagtctggtgggctcaataaatcaaataaagcaaaa
catttctcatttttgaataaaagcatttatcacacagtgtttgttcactcatggtcacaa
gattgattggttcccagtatcatagcatatattgaagcatttttgattttgtttttccag
TGGGCAAGTTACGGAAGCAATGGCTAAAGGAAAGTATCTCTGATGTCGGCTTTGGGATGC
TGAAGTCTGTCAAGGAATATGTGGACCCCAATAACATCTTTGGAAACAGAAACCTTTTAT
AA
atccattagtaccattacaaaaaaatgtcaattttttttttaagttttcaactgtggtta
tactagtaatcaaatatatcatggactatattttggatacatttgtttctttggtttaaa
ataagtttgttttcattctgtagtttgttttgtttctacatctatggattgacagatagt

--------------------------------------------------------------------------------