--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5665 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (3 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        791        897   1   Internal    107    68    Marginal
aaggcaggtagaggcgctgggcggggtccgggcgcgggaagtcccgggctcacgcctccc
gcgaagcgcaccttcagcccacctcggtccgcccaccgccccgcctcccgcccgctcccg
cgcccgcctccagtctccgccttcctccagccgctctccccgctccccactcccctgcag
GCGCGGCTGGGGCGAAAGCCTGCGAGCTGAGCGGGCGCAAGGTCCTCCGCGCCTCCTTTA
AGAACCGGCCCAGCCCGGCCCGCGCCCCCAGAGCGTACGGCATCCGC
gtggcgggagggcgcgactttctccggtcccgggcgggacggggacggcggcgggacaac
ttgggaaacttctctggggcggacggcagggaccccgggcaccggtggaggaggatgtag
gagggcggctgctggtcctgggtgttcccgacctcctaggccccgctcgtccaggccatg

Exon  2 +       1201       2544   0     Single   1344    78        Good
ggcggctgctggtcctgggtgttcccgacctcctaggccccgctcgtccaggccatgggg
ctccagcgccctcggcgccgcccgaggggcgacgctcttgtctagccgagccgggcagcg
ctgtcgtccacggtgcgcactgggcgggcagcgctccctctgcccacctcccgccccgtc
ATGGACCACCAGGACCCCTACTCCGTGCAGGCCACAGCGGCCATAGCGGCGGCCATCACC
TTCCTCATTCTCTTTACCATCTTCGGCAACGCTCTGGTCATCCTGGCTGTGTTGACCAGC
CGCTCGCTGCGCGCCCCTCAGAACCTGTTCCTGGTGTCGCTGGCCGCCGCCGACATCCTG
GTGGCCACGCTCATCATCCCTTTCTCGCTGGCCAACGAGCTGCTGGGCTACTGGTACTTC
CGGCGCACGTGGTGCGAGGTGTACCTGGCGCTCGACGTGCTCTTCTGCACCTCGTCCATC
GTGCACCTGTGCGCCATCAGCCTGGACCGCTACTGGGCCGTGAGCCGCGCGCTGGAGTAC
AACTCCAAGCGCACCCCGCGCCGCATCAAGTGCATCATCCTCACTGTGTGGCTCATCGCC
GCCGTCATCTCGCTGCCGCCCCTCATCTACAAGGGCGACCAGGGCCCCCAGCCGCGCGGG
CGCCCCCAGTGCAAGCTCAACCAGGAGGCCTGGTACATCCTGGCCTCCAGCATCGGATCT
TTCTTTGCTCCTTGCCTCATCATGATCCTTGTCTACCTGCGCATCTACCTGATCGCCAAA
CGCAGCAACCGCAGAGGTCCCAGGGCCAAGGGGGGGCCTGGGCAGGGTGAGTCCAAGCAG
CCCCGACCCGACCATGGTGGGGCTTTGGCCTCAGCCAAACTGCCAGCCCTGGCCTCTGTG
GCTTCTGCCAGAGAGGTCAACGGACACTCGAAGTCCACTGGGGAGAAGGAGGAGGGGGAG
ACCCCTGAAGATACTGGGACCCGGGCCTTGCCACCCAGTTGGGCTGCCCTTCCCAACTCA
GGCCAGGGCCAGAAGGAGGGTGTTTGTGGGGCATCTCCAGAGGATGAAGCTGAAGAGGAG
GAGGAGGAGGAGGAAGAGTGTGAACCCCAGGCAGTGCCAGTGTCTCCGGCCTCAGCTTGC
AGCCCCCCGCTGCAGCAGCCACAGGGCTCCCGGGTGCTGGCCACCCTACGTGGCCAGGTG
CTCCTGGGCAGGGGCGTGGGTGCTATAGGTGGGCAGTGGTGGCGTCGACGGGCGCAGCTG
ACCCGGGAGAAGCGCTTCACCTTCGTGCTGGCTGTGGTCATTGGCGTTTTTGTGCTCTGC
TGGTTCCCCTTCTTCTTCAGCTACAGCCTGGGAGCCATCTGCCCGAAGCACTGCAAGGTG
CCCCATGGCCTCTTCCAGTTCTTCTTCTGGATCGGCTACTGCAACAGCTCACTGAACCCT
GTTATCTACACCATCTTCAACCAGGACTTCCGCCGTGCCTTCCGGAGGATCCTGTGCCGC
CCGTGGACCCAGACGGCCTGGTGA
gcccgcctgcgctgcccctgtggggttggtgcggtggcgccggggtcaccctgcttcttg
ccctgctgtgtgtggctgcctcccctgggctttctgctccctgcccagatcctgtaggcc
tcatcttaggaaccccttgggaggggtgggcaggggggctgctagcaagggtcccagtga

Exon  3 +       2176       2544   0   Terminal    369    91   Excellent
gggacccgggccttgccacccagttgggctgcccttcccaactcaggccagggccagaag
gagggtgtttgtggggcatctccagaggatgaagctgaagaggaggaggaggaggaggaa
gagtgtgaaccccaggcagtgccagtgtctccggcctcagcttgcagccccccgctgcag
CAGCCACAGGGCTCCCGGGTGCTGGCCACCCTACGTGGCCAGGTGCTCCTGGGCAGGGGC
GTGGGTGCTATAGGTGGGCAGTGGTGGCGTCGACGGGCGCAGCTGACCCGGGAGAAGCGC
TTCACCTTCGTGCTGGCTGTGGTCATTGGCGTTTTTGTGCTCTGCTGGTTCCCCTTCTTC
TTCAGCTACAGCCTGGGAGCCATCTGCCCGAAGCACTGCAAGGTGCCCCATGGCCTCTTC
CAGTTCTTCTTCTGGATCGGCTACTGCAACAGCTCACTGAACCCTGTTATCTACACCATC
TTCAACCAGGACTTCCGCCGTGCCTTCCGGAGGATCCTGTGCCGCCCGTGGACCCAGACG
GCCTGGTGA
gcccgcctgcgctgcccctgtggggttggtgcggtggcgccggggtcaccctgcttcttg
ccctgctgtgtgtggctgcctcccctgggctttctgctccctgcccagatcctgtaggcc
tcatcttaggaaccccttgggaggggtgggcaggggggctgctagcaagggtcccagtga

--------------------------------------------------------------------------------