--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10353 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1232       1446   0    Initial    215    84        Good
atgattggccgccgggcccgccctccagaaagccccgcggggctcgcgtaggctgcaggc
tcggggagggagggcagcggcgccgcgtcgggagccgccgccgtcccggtcctcccgccc
gcccgcccatccggtgcctcctgcagcccgcctgctgggcagggccggcgcggcccggcc
ATGGAGTCCTACGACATCATCGCCAACCAGCCTGTGGTCATCGACAACGTGAGGCCCGGC
AGCCAGGGGGAGGGCGGGCGCCCCGCCCCCGGGGGCGCACGCGGCGGCGCAGGGAGAGAC
CCCCGCCCGCCTCGGCGCGTCCTCCGCTCACTGCGTGGCCGTCGCCCCCGCCGGGCCGCT
GGCTTCGCCCCGGGGGCGCGCGCCCTCTTGGCCTT
gtaaggccggccatggggcgagccccctcgcccgcgtcgcagagcctcttccccgacccc
tccccgagtcgggcggggaagttcaggagagcttgagtgacagccgggcggccgggcggg
gacgcgccccggactcttctcagttgagagtgcggttcctgggcaggtttccacaccagt

Exon  2 +       4435       4551   0    Initial    117    61    Marginal
tctgctgaccgtgccttctgaccctgagcttctcgtcctgcctaggccccctctctagcc
ccgaaccccataggccccagttccaacctgtgccccccagccacatcctggtgtttggag
gccaggtaccctctgggcgactatggttggatttcggtttttctggacacaagctctgcc
ATGCTCCCTGCCCACCTTGCTGACGTTATCCGTCCTAACAGTGTCGGGCGGCCGAAGCAC
ATGCGGGTGATGGCTGGAGCCCTGGAGGGGGACCTCTTCATCGGACCAAAAGCAGAG
gtaacaccgaggagcctgcctttccctgggggtggggtcctcagttgcaggaacatggca
tgtgttcttgggcctctgctggtgacctcccgggtacctcctccaggctccagctgggaa
gtgctgtgcaggggcacctccccctgagatggggcagcagttcctcttctagggagcatg

Exon  3 +       5645       5770   0   Internal    126   100   Excellent
aggtgagcccatgctgagttcaggacccgccacagaccctgggacacccagtgagcaggg
gtggttctggtcagggcaggtgaggttctggtcagggcaggtgagggtcagcttccagga
gggcggaaagcagccgctgagcaagggccgggtgccacacctcccttcccaccccaccag
GAGCACCGGGGGCTGCTGACCATCCGCTACCCCATGGAGCACGGCGTGGTGCGAGACTGG
AACGACATGGAACGCATCTGGCAGTACGTCTACTCCAAGGATCAGCTGCAGACCTTCTCG
GAGGAG
gtgtggcggctgcccctcctgcatgctctgcattctcctggccatgcccctctcctctgc
gtccctcctcgccgggctcccacatttcccttctacatttctagagggcctgctgccttt
ccgtgtgtgtctgggtgcgcatacgtacccagtggctgctaggcagaatcttccaaagag

Exon  4 +       6119       6232   0   Internal    114   100   Excellent
tcttccaaagagagccggatctccggaagagtaactgccagcagataaagggatggggcc
ctcaggaggggtaggaggctgagctgcctgtgcgccagcgggtgtggttctctggaaaga
gccttttagggccttgcaagttgcctcctctgatgcctacaactgtcccgtccctcgcag
CATCCTGTGCTCCTCACGGAGGCCCCGCTCAACCCGAGTAAGAACCGGGAGAAGGCGGCA
GAGGTGTTCTTTGAGACCTTCAACGTGCCGGCCCTGTTCATCTCCATGCAGGCT
gtgctcagtctgtgagtgctccctaagcctggcctccctgagtcctgtcctccctgtgcc
gtcctgcttgccatgaccagggtctgacttccctggaaaaacagccccttgatgactgtt
cctctagggagtccctcgtgtcctctcttcagactagataatgcagatgtgccagggttc

Exon  5 +       6564       6713   0    Initial    150    63    Marginal
gactagataatgcagatgtgccagggttcctcccctgggtgaggaggtccccgtgcctca
gtggctgaggtgaggggatgctgacctggtgacaggtacgcaacaggacgcacgacagga
gtggttctagactcaggggacggggtcactcatgctgtgcccatctatgagggctttgcc
ATGCCTCACTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTACCTCCGA
CTCCTGCTGCGCAAGGAAGGGGTTGACTTCCATACCTCGGCTGAGTTTGAGGTTGTCCGG
ACAATCAAAGAGGTGACAAGGGGCGAGAGG
gtgtggacacgacctggggtgaggaaagggtggcaccaaggcacaggtgtcccaggtgca
gccttctgagggctgtgtccctgtccccgcagcgagcgtgctacctgtccatcaacccac
agaaggatgaggctctggagacggagaaggtgcagtacacgttgccagacggcagcacgc

Exon  6 +       6806       6898   0   Internal     93   100   Excellent
cctgctgcgcaaggaaggggttgacttccatacctcggctgagtttgaggttgtccggac
aatcaaagaggtgacaaggggcgagagggtgtggacacgacctggggtgaggaaagggtg
gcaccaaggcacaggtgtcccaggtgcagccttctgagggctgtgtccctgtccccgcag
CGAGCGTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACGGAGAAGGTG
CAGTACACGTTGCCAGACGGCAGCACGCTTGAT
gtaagtggccgggcctggcactggagtggcagccgatgcccagcctgggggaaggggtag
cccgcttctccaggaagcctgtctgcctcaatcttgtacactaaaggtggggcctgcacg
attccgggcccccgagctgctgttccagccggaccttgtcggggatgagagtgaggggct

Exon  7 +       7047       7158   0   Internal    112    88        Good
agtacacgttgccagacggcagcacgcttgatgtaagtggccgggcctggcactggagtg
gcagccgatgcccagcctgggggaaggggtagcccgcttctccaggaagcctgtctgcct
caatcttgtacactaaaggtggggcctgcacgattccgggcccccgagctgctgttccag
CCGGACCTTGTCGGGGATGAGAGTGAGGGGCTCCATGAGGTGGTGGCCTTCGCCATACAC
AAGTCCGACATGGACCTGCGCCGGACGCTGTTCGCCAACATCGTGCTCTCAG
gtggctcaacgcttttcaaaggtactgtggcttgagagttggtggtggtgagacgaggcc
cagggcagctggaccctcagagagtatacccctacccagagccatattctgttggctttt
tggtggtgctcaatgaacattttttttaacagaccaaaatttaaaattaaattttgttta

Exon  8 +       8162       8264   2   Terminal    103    86        Good
ctcaagggagggctctgggaggagaccactttaccctggatgctcctcccattgttggcc
taggccacgtggaggtgggtggatttccctcccaaattagggaaatgcaactctgagcac
ccaggaaggtggttggctccctgacaggtccacagcaatactatccctccatccccacag
CGGCTCCATCCTGGCCTCGCTGGACACTTTTAAGAAGATGTGGGTGTCCAAAAAGGAGTA
TGAAGAGGATGGCTCCCGTGCTATTCATCGCAAAACTTTCTAG
tgcccaaggagggcggggcatgttgggagagggggagggaggggagacagagcctttaac
cctttttggtcttggctcgtatactaggcttagggtcccctgcatgccctgaacccctgg
gtgggtggcacagcagtgcccccctgcagccttcccctctacacaggacatgcacacaca

--------------------------------------------------------------------------------