Gene ZNF432 Variant 1
DNA : 17.18 KbNT_011109
mRNA : 4513 bp NM_014650
CDS : 1959 bp NP_055465
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  21 bp
agtaagttcagcttttaagaggtcgcggcgattccaaggagagtcaggtcagtgtgtggg
tcagggcgtggaaacgtggtgggagggagctttctgagggcgtctgcgttgttggtggcg
ctatatggtggaggtagcgcgggggttgggggaggcgggggcgggtgtttccttttggag
GGGAGCTGGTAGGAGTCCCTG
gtgggtgtctgtgataggatatctttggggtccctcatggaggctctggtggtcagtgat
taaaggcctgaatagatcaacgaccaagagtactgaggtcagggattgtggtcctcgcgg
gtcactccccagtggggctcagtgattgagaatcgatggggtggcttttgtcaacgaatg
EXON 2  207 bp
attctcctttgtgacctcccctttcatcttcatgttacttccacacttcaccgaagaaag
gcatttggcctacattgagggtcttgtgtttccttggtttgagagaaccaaataaagaga
caaatattcagggccacgtgttaaggtgaatgtacccctgaaagttgttttgctcttcag
TCCACAGGTCCTGGCTACCCTGGGAAGAGACAAGAAGTAAATGAAGAAAGAGGAAGATTC
CAGGACCTAGATATGATTTCTGTGGACACCCTTCACTGGTGACTGAAGTTTCTAAATAGA
AATTTAAGGCAGATCCAGAGGAGACAAAGACAGAGTATCCCAGGTGCTGGCCATTTCCCA
CAACAGAAGAAAATGATCAATGCCCAG
gtgactttttctctattttattctctcctttattccatagtggatttgtagagacccgta
agaaatcatttcagaatctagagagaaataaactttaaatctaactccaacatcatggca
aagtaagatcaggaatatagtgtttatgtgattcctacaaaatgactgatgttggaaaat
EXON 3  127 bp
tggggcactgtgcaattatagaatacttggagattctctggcaatattaaaaaatacaat
agacttatagatggatgcagtctatatgtttaatgtgagcgggacaacttcccttcactt
tcttttcatgtcagtaaaagagaaacacttcctattaagcaaggctctgttttcttacag
GAATTGCTGACACTGGAGGATGTTACTGTGGAGTTCACCTGGGAGGAGTGGCAGCTCCTG
GGCCCTTTTCAGAAGGATTTGTACCGGGATGTGATGTTGGAGATCTACAGCAACCTGCTA
TCAATGG
gtgaggacagctgctctgtgtcacctggagggtgcccagtctgtggcctttgctttctca
gttgcttacccttggaagttactgcagtgctctgaatattagatttttggcacatcctct
ggcttctgataaaaggatataccgtcacccctcagtgtccaagagggattggtttcacaa
EXON 4  96 bp
tgaatccctggatgtgaaattttcagatattaaggtctgactgtaatctgccctttcctg
agagagaagcctctactttcagatgtgaaaactgtctagttacttaaatgtaacattctc
tcacattacataccccagcccaatccagtgtgtctgtcttctattatttcccgtaaacag
GTTATCAAGTCAGCAAACCAGATGCACTCTCCAAGTTGGAACGAGGAGAAGAACCATGGA
CAATGGAAGATGAAAGGCACAGTCGAATCTGTCCAG
gtatgtgagaagcagcaagatgcgtaagtaatattatagtcagtgaaagaaggctctgtg
ggtgtctgaggacacagaagcagtgcctacattaggaatgggaatcgttttccctccaca
agaaacccttcccatcttattttaaggttgcattctcctttagtaccatacatctgtcct
EXON 5  4062 bp
gcggaggttgcagtgagctgagatcataccactgcactccagcctgggtaacagagcgag
actctgtctcaaaaaataataataataaacaaaataaaacaccaaggatttttttttcta
agaagacagttttatccccaacaagattataaaaggattcattgttctcttctttcctag
AAAACAACGAAGTTGATGATCATCTGCAGGATCACTTGGAAAATCAAAGGATGCTGAAGA
GTGTGGAACAATACCATGAACATAATGCATTTGGAAATACTGCCTCTCAAACCAAAAGCC
TTTGTCTTTTCAGGGAAAATCATGATACATTTGAGTTATATATAAAAACTTTGAAATCAA
ATTTAAGTTTAGTCAACCAGAACAAAAGCTGTGAAATTAACAACTCTACTAAATTTAGTG
GAGATGGGAAATCATTTCTTCATGGTAACTATGAAGAACTTTATTCTGCAGCTAAATTCT
CTGTAAGTACAAAAGCCAATAGCACTAAATCCCAAGTCAGTAAGCATCAGAGAACTCATG
AAATAGAAAAAAACCACGTATGCAGTGAATGTGGGAAAGCGTTTGTCAAGAAGTCTCAGC
TCACTGATCATGAGAGAGTTCATACAGGAGAAAAACCTTATGGATGTACTTTGTGTGCAA
AAGTGTTCTCCAGAAAGTCCAGGCTAAATGAACATCAAAGAATTCATAAAAGAGAGAAAT
CTTTTATATGCAGTGAATGTGGAAAAGTCTTCACTATGAAGAGCCGTCTGATTGAACATC
AGCGAACTCATACTGGAGAGAAACCCTACATATGCAATGAATGTGGAAAAGGCTTCCCAG
GCAAGCGTAATCTCATTGTACATCAGCGAAATCATACTGGAGAGAAATCCTATATATGTA
GTGAATGTGGAAAAGGCTTCACTGGGAAGAGCATGCTTATTATACATCAGCGAACTCATA
CAGGAGAGAAGCCCTACATCTGTAGTGAATGTGGGAAAGGCTTCACCACAAAACACTATG
TCATCATACATCAACGAAATCATACAGGAGAGAAACCATATATATGCAATGAATGTGGGA
AAGGCTTCACCATGAAGAGCCGTATGATCGAACATCAACGAACTCATACAGGAGAGAAAC
CCTACATATGCAGTGAATGTGGAAAAGGCTTTCCCAGGAAGAGTAATCTTATTGTACATC
AGAGAAATCATACAGTAGAGAAGTCATATCTATGTAGTGAATGTGGAAAAGGTTTTACTG
TGAAAAGCATGCTCATCATACATCAGCGAACTCATACAGGAGAGAAGCCCTACACATGCA
GTGAATGTGGGAAAGGCTTCCCCTTGAAGAGTCGGCTGATTGTACATCAGCGAACTCATA
CTGGAGAGAAACCTTACAGGTGCAGTGAATGTGGGAAAGGTTTCATTGTGAATAGCGGAC
TGATGTTACATCAGCGAACTCATACTGGAGAGAAACCGTACATATGCAATGAATGTGGAA
AAGGTTTTGCCTTTAAGAGCAATCTTGTTGTACACCAGCGAACTCATACTGGAGAGAAAC
CCTTTATGTGCAGTGAATGTGGAAAAGGCTTCACCATGAAACGCTATCTCATTGTACATC
AGCAAATTCATACAGAAGAGAAATCTTGTATATGTAGTGAATGTGGAAGAGGCTTTGCCA
AGGAAACAGAGCTTGCTTTACATAAGCAAGTTCATACTGGAGAAAAACCTTATGGATGTA
ATGAATGTGGTAAAGGCTTCACTATGAAGAGCCGTCTAATTGTTCATCAACGAACTCATA
CAGGAGAGAAACCCTTTGTATGCAGTGAATGTAGAAAAGCCTTCTCCTCAAAGAGAAATC
TCATTGTACATCAGCGAACTCATAATGGAAACAAACCCTGACAATGCAGTGGACATGTTC
ATGCCTTTGGGAAGAAAATCTGCCTTGTACAACATCAGAGATTTCACAGTATAGATTTTC
TACATGTGTACTGAGTATGAAAAATCATATTTCAAAATCCAGTGTTATTCACTAGGATGA
ATGCTATCAATGTCAGAAAGGCTTCAACATGAATTCAGGCTCTGAATTCTTTGATGTACC
AATGTATAGAAAATTACTCATCTGAGAGAGAGTCTGTGGATTGGGGGTAACCTTTCATTT
GTCAACCTTCATTAAAACTATGACAACGTCCACATGACAAATGTGTAAGGTACATAGTCC
TTTTGCAGAGAATCTGAACTGATTACATACAAACAAATTCATGCAGAGAGAAAACCACGT
TAGTAATGTGAACTGATTAAACAGCAGTGTGCTCCTAGCATACATGCATATAGGCAGTGT
AGAGCAGCCTGTTGCTAGATTTTCACCCTTGGAAGACAATGCAATTTCCAGGAGCGAATT
TTAATGAATGCAGAGAATGCACTAGTGCCTTCGGTGATTAATTACCTCATATTTTATGTC
ACAATAAACATGTAGGAAATAAACTTGATACATCCAATGCAGAAAAGTCTTGAAAATTTT
CTAAGTAACTATGTCTTGAAAAGTATTTACTGAGATAAATCTTACAAAGGAGTAGGCTAG
GAAAGCCTTCTATGGGAAGAAAGACCCTATCTCTTCAGTGATCATAATAGATCATCAATG
AACTTACACATACTAGCAGCATTATCATGGGAAAGCCTTTGCCCAGAAATAAAACCTTAA
CAGTTGGCAGATATATTTCATACTGGAGAACAAGTTTCAGATGGCAGTGAATACACGAGG
ATTTCAGTGATACATGCTGCCTCATCATCATTACTTCATACAGAAATAAAACTTATATGA
AGAGTAACTTTAAAAAGGATCAGGAAATTCATGAAGTAAAAAAGTCTCATGAAAATGATA
CATAATGCCGGGCATGGTGGCTTGCACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGG
GTGGATCACTTGAGGTCGGGAGTTCGAGACCAGCCTGACCAACATGGTGAAGCCCCCCTC
TCTACTAAAAATACAAAATTAGCCGAGCATGGTGGCTCACGCTTGTAATCCCAGCTACTC
TGGAGGCTAAGCTGGAGAATCACTTGAACCTGGGAGGCAGAGGTTTCAGTGAGCCAAGAT
TGCGCCATTGCATTCCAGCCTGGGCAACAAGAGCGAAACTCTGCCTCAAAAAAAAAAAAA
AAAAACCATATTTGAGGACTGTCACAAATCTAAACTCATGATACACTTGATATCTATTCT
GTGACAGCATACCTTGCATCATATTATCAATGATTCCATAATTGTAAAGCGGGCTGTTCT
TATCACTGATTAAATTTTAATCCTATATATAACACAGGTGTTTTCTGTGCCAATCTGGTG
TTATTTATTAGTTCTTACATATTATAGGCCCCAAATTTATTTTTTTCAATTTACTGATAA
ATGTAATTCAGTATATTTGGATGTGTTTATCCAAGTTACTAGGTACCATTATGTAGTTTA
CAAAAATGCCTTAAATGTTATTTTTCTAAAATTTGTTTTGAAATAATTCTAGATTCACAA
GAGATTACAAAATATACAAAAGTTTCCTGAGTATTCTTTGCTTAGCATCATCAATGTTAT
CTTACATAACCATAATAATAAAAACCACGGAGTTCTGCTCTTGTTGCCCAGGTTGGAGTG
TAATAGCACGATCTTGGCTCACTGCAACCCCGCCTCCCAGGTTCAAGAGATTTTCCTGCC
TCAGCCTCCTAAGTAGCTGGGATTACAGGCACCCACGACCACGCTCGACTAATTTTTGTA
TTTTTAGTAGAGACGGGGTTTCACTGTGTTGGCCAGGCTGGCCTTGAACTCTCGACCCCG
GGCGGTCCACCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCACGCC
TGGCCTCCTCTTGCTACCTCTTTATACTCACACTGTCCTCCCAATATGACCCATGGTAGC
CACTGATCCCATTACCCTAATTTTGTTATTTCAAGAATGCTATTAAAATGGAATCGTAAG
GTACGCAAGCTTTGAGATAGGGCTTTGTTCACTCAGCAAATTACCCTTAAGATCTATCCA
AGTTGTTAGGTGTCTAAATAGTTTTAATTTTTGTTACTGAGTTAGTATTCTTTTAAATGG
ATGCACCAGGGTTTGTGTATCCATTCACTGTTGATGGACATTTGGGTTGTTTCCAGTGTT
TTGCTGTTATAAATAAAGATGCTGTGACTATTTGTGTACCCG
atattgtgcgaacgttaagtttttatatatttgggatagacactgggggcatgactgctg
gcgaatatggtaaatgtgtttaactttataagaaatggccaaactctttcccagagtggc
tgtactagtttacattcccaccaccaatgtgtaagcattccatgccctttctagctcttg