Gene ZNF28 Variant 1
DNA : 21.99 KbNT_011109
mRNA : 2318 bp XM_209154
CDS : 2157 bp XP_209154
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  88 bp
tcggcccaatgcaagctgtatctcccgggttcaaaagcctgagaacatggcctgggagga
ggctgagactcacaggtcccgctccggccccgccctctgcgggttctaaagggcaaggtc
tcgccgcttcgcgccccgcccacacctcacccgggccccgctcgcctcctcgttggctcc
ACCCAGGCCTGGTTTCTGTCCTGCGCGCGCAGATTCGCGCAGACCAGGAAGCGGATCCCG
TGGAATGACGGTGACGCCGCGGCGGGCG
gtgagttttgctctgtgtggtgttaagtctgagcttcccaggtccccggcacttctgtac
atgggatgtggggtccccctagacctggaagttctcccctttcttcgttcactcagagca
aatggagatgttctactgggagtccggaagccccttctttttaggtttaaagtcgccctg
EXON 2  88 bp
gtgtgggcttctccaggagtagagtgggagttttcctgtaggaattttttgttcgtggtg
cggtaggcagcataggggaccatatttcctcaaggtgaagtctcctttgtatgtgttgtt
gtgttacagggaggggatgtgttgattctgagcaataaacaacatatttttaacattcag
GATTGACTTCTAAAGAATCTTGGTACGTGAGGAAGAAACCCAGAAGAGGAAGAGGAAAGC
AAAGGAGTCAGGGATGGCTCTTCCTCAG
gtgagatggtattctcggtggattgctctgtctccttcctttcagaaacgctgggccttg
gagttgggagtcttctctgagtctgaagtgtcctgcctgatatgtttgctcaccctcacc
catgccttccttcagttcatctcatctcgcttagattccatctctggtgacccagtgaca
EXON 3  127 bp
aaagtgtgtcttgatcacttcaaaaagtataataaaaacatcatgtggtgaaaaatccgt
cactcggatttgtgagaacattcactacaactaaatccatgctttccccctctcttgtca
ttttctgtaaagataagaactccaccataaccatttggttaaaatgtgtttccatttcag
GGTCTATTGACATTCAGGGACGTGGCCATAGAATTCTCTCAGGAGGAGTGGAAATGCCTG
GACCCTGCTCAGAGGACTCTTTACAGGGATGTGATGCTGGAGAATTATAGGAACCTGGTC
TCCCTGG
gtgaggataacctcctggggatgtgcccttgtgtatctttgtattttctcttgttgcctc
ttgggagccacatccttacttgactaaaatggaagccgtattgattttgaaatgaaaagc
ttcatgatgtagcatctggactttcactgtcccctttgtttagaggttctgcattcttca
EXON 4  2015 bp
gaaagacatataatcgccctttatttattaaagaatcttactccttttgtgttcttaaac
tttgaagatcatgtttgggaagtttaaaataagtattgttttttgtgtcatatttacaca
tttcagtattatacaccatctgtacttcattggaaacctattggtgtttatattttgtag
ATATCTCTTCCAAATGCATGATGAAGACATTCTTCTCAACAGGGCAAGGCAATACAGAAG
CGTTCCACACAGGGACATTGCAAAGACAAGCAAGTCATCACATTGGAGATTTTTGCTTCC
AGAAAATTGAGAAAGACATTCATGGCTTCCAGTTTCAGTGGAAAGAAGATGAAACAAATG
ACCATGCAGCACCCATGACAGAAATCAAAGAGTTGACTGGTAGTACAGGCCAACATGATC
AAAGGCATGCTGGAAACAAGCATATTAAAGATCAGCTTGGATTAAGCTTTCATTCGCATC
TGCCTGAACTGCACATATTTCAGCCTGAAGGGAAAATTGGTAATCAAGTTGAGAAGTCTA
TCAACAATGCTTCCTCAGTTTCAACATCCCAAAGAATTTGTTGTAGGCCCAAAACCCATA
TTTCTAATAAGTATGGAAATAATTCCCTCCATTCTTCATTACTCACACAAAAACGGAATG
TACACATGAGAGAAAAATCTTTCCAATGTATTGAGAGTGGCAAATCCTTTAATTGTAGCT
CACTTTTAAAAAAACATCAGATAACCCACTTAGAAGAGAAACAATGTAAATGTGATGTAT
ATGGCAAGGTATTTAATCAGAAGCGATACCTTGCATGCCATCGTAGATCTCACATTGATG
AGAAACCTTACAAGTGTAATGAGTGTGGCAAGATCTTTGGTCACAATACATCCCTCTTCC
TTCACAAGGCGCTTCATACTGCAGACAAACCTTATGAATGTGAAGAATGTGACAAAGTTT
TCAGTCGCAAATCACACCTTGAAACACATAAGATAATTTATACTGGAGGGAAACCATACA
AATGTAAGGTTTGTGACAAAGCTTTCACATGTAATTCATACCTAGCAAAACATACTATAA
TTCACACTGGAGAGAAACCTTACAAGTGTAATGAATGTGGCAAGGTTTTTAATCGACTGT
CAACCCTTGCACGCCATCGTAGGCTTCATACTGGAGAGAAACCTTATGAATGTGAAGAAT
GTGAAAAAGTTTTCAGTCGCAAATCACATCTTGAAAGACATAAGAGGATTCATACTGGAG
AGAAACCATACAAATGTAAGGTTTGTGACAAGGCTTTTGCATATAATTCATACCTGGCAA
AACATAGTATAATTCACACTGGAGAGAAGCCTTACAAGTGTAATGAATGTGGCAAGGTTT
TTAATCAACAATCAACTCTTGCACGCCATCATAGACTTCATACTGCAGAGAAACCATACA
AATGTGAAGAATGTGACAAAGTTTTCAGGTGCAAATCACACCTTGAAAGACATAGGAGGA
TTCATACTGGAGAGAAACCATACAAATGTAAGGTTTGTGACAAGGCTTTCCGGAGTGATT
CATGCCTTACAGAACATCAGAGAGTTCATACTGGAGAGAAACCATACATGTGTAATGAAT
GTGGCAAGGTTTTTAGTACAAAAGCAAACCTTGCATGTCATCATAAACTTCATACTGCAG
AGAAACCGTACAAATGTGAAGAATGTGAGAAAGTTTTCAGTCGCAAATCACACATGGAAA
GACATAGGAGGATTCATACTGGAGAGAAACCGTACAAATGTAAGGTTTGTGACAAGGCTT
TCCGGAGGGATTCACACCTGGCACAACATCAGAGAGTTCATACTGGAGAGAAACCTTACA
AGTGTAATGAGTGTGGCAAGACCTTCCGTCAGACATCATCGCTTATAATCCATCGTAGGC
TTCATACTGGAGAGAAACCTTACAAGTGTAATGAGTGTGGCAAGACCTTCAGTCAGATGT
CATCCCTCGTATACCATCATAGGCTTCATAGTGGAGAGAAACCTTACAAGTGTAATGAAT
GTGGCAAGGTTTTTAATCAACAAGCACACCTTGCACAGCATCAGAGAGTTCATACTGGAG
AGAAACCTTACAAGTGTAATGAGTGTGGCAAGACCTTCAGTCAGATGTCAAACCTTGTAT
ACCATCATAGACTTCATAGTGGAGAGAAACCTTGA
aagtgtaatgagtgtggcaagaccttcagtcagatgtcaaaccttgtataccatcataga
cttcatagtggagagaaaccttaaaagtgtaatgagtgtggcaacaccttccatcacaat
tcaacccttgtaagtcacaaagccattcatactggagagaaactttacaagtgtaatgaa