Gene WDR18 Variant 1
DNA : 10.23 KbNT_011255
mRNA : 1545 bp NM_024100
CDS : 1299 bp NP_077005
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  243 bp
cgcctccccagatctctaagcaggccgcgcgaccctcgagtctcaggtaagcgggaaatc
ccacttcacaagaaagcccctctctccgaggcacgggcgcatgcgcgggtcggccacccg
ctggggccgcggggccgccgctctggcccgcgtggggcagtcgtccgcgtctcgctcatg
ATGACGCACGTCCGGGGCGGTGGGGAAGGCAAGATGGCGGCGCCCATGGAGGTGGCCGTG
TGTACGGACTCGGCGGCCCCGATGTGGAGCTGCATCGTGTGGGAACTTCACTCGGGCGCC
AACCTGCTCACCTACCGCGGCGGCCAGGCGGGACCCCGCGGCCTGGCGCTGCTCAATGGC
GAGTATCTGCTGGCGGCGCAGCTGGGCAAGAATTACATCAGCGCCTGGGAGCTCCAGCGG
AAG
gtgcggcggtgcggtctcgctgctggggtcatggggcgcccgaggctgaagtcgggggat
gggttggtgggggccgcgtgcacccttagtcggaattggcgtggggaggggaggtggtct
ccgttcgggcgctctgcgcatgcgcgggtctgggggctttggggagatacgtgcgacctg
EXON 2  111 bp
cttgcaggggcgaacacttccttgctggaccatgcatttgctcaaaccaccctgctcccg
actcctcttcctggttctctgacttagccattgcccaggcgtcccctcccctcgccctcc
actgctgtagtagctcccgtgtcctgcatggggctcacgaggctgactgtgcatccttag
GACCAGCTCCAGCAGAAGATCATGTGCCCCGGGCCTGTCACCTGTCTGACTGCATCACCC
AATGGTCTCTACGTCCTGGCAGGAGTTGCAGAAAGCATCCACCTGTGGGAG
gtaagaggagcaaagcgtgagcgtttcccacaggacatctcagcccatctgagctttgcc
tgcagggcaccagggaacaaccatgcggcctggggccctgggatgggtgactgctcaggg
gttatagcctaagcttcaccctgctgcctcctttctccaggtcccctcgagacttgcgaa
EXON 3  134 bp
aggccccgctgtacctgctggccgctgccctgacagggtcaccccgcagtcctggggcag
ggcaggcagggggcgacagtgtggccatggccgtgcagtggtgggttcctggggctgcag
cccccctttcctcccctggggctttcctcccctgacctggataccctctgcccctcacag
GTCTCCACCGGGAACCTTCTGGTCATCCTGAGTCGACACTACCAGGACGTCTCCTGCCTT
CAGTTCACAGGGGACAGCAGCCACTTCATCTCAGGGGGCAAGGACTGCCTGGTGCTGGTT
TGGAGCCTCTGCAG
gtagcgccttgcgcactcaggcctgcacctggaactgcacccgggctcaggcggggagag
gaggcgccaaggcccctggcgggaaggggcttctctcttgggggctggagtgcagaggac
ggagtgatcatcccaggggtcctggctgcccacactggggtctggtttgttctgggggcc
EXON 4  142 bp
gcccacactggggtctggtttgttctgggggccgtgggggcccagccttgagtttactca
ggtgaggcaggccaggctgctgagtggaggcaggtgtgtgcgtgaggtgggtgctggagg
cgtggactgccctgttccctccgctccccgcctgctgagcacctgccccaccccgctcag
CGTGCTGCAGGCCGACCCCTCCAGGATTCCGGCGCCCAGGCACGTCTGGTCTCACCACGC
GCTCCCCATCACGGACCTGCACTGCGGCTTTGGGGGCCCCCTGGCCCGGGTGGCCACCTC
CTCACTGGACCAGACGGTGAAG
gtacgccgcccccaccccaccacggtccatgagcggagcccagcagccgcaggtcctcag
ccaggaatgcaggaatcgcctcctcccgctccctgctgtcaggactccagacggctttta
atcccctggtgctctgagcccaaggacgtccagggaggtctgccagcctggaaattccta
EXON 5  144 bp
atttcagcacaggccatgtcccctggcccccaagacccacatggtgacggctttcaccca
aagtcgcaagccctagggccagaggacagccgacgcctgacctccctggtgcccctgttc
ccatggggtcctcgggttccccctgccgggccgagccccacgccctttgcccacccgcag
CTATGGGAGGTCTCCTCGGGGGAGCTGCTGCTCTCCGTCCTCTTTGACGTGTCCATCATG
GCAGTGACCATGGACCTGGCTGAGCACCATATGTTCTGCGGGGGCAGTGAGGGCTCCATC
TTCCAGGTCGACCTCTTCACCTGG
gtgagtgccgcggtctgcgggctgcaccctgccctggggctgagggcatcgggcctgcgg
ctcacacacgtctcggccttcgcagcccggacagagggagaggagcttccacccagagca
ggacgccgggaaggtcttcaaagggcacaggtggggacgtgggaacggggcgggggctcc
EXON 6  65 bp
tgtccatcatggcagtgaccatggacctggctgagcaccatatgttctgcgggggcagtg
agggctccatcttccaggtcgacctcttcacctgggtgagtgccgcggtctgcgggctgc
accctgccctggggctgagggcatcgggcctgcggctcacacacgtctcggccttcgcag
CCCGGACAGAGGGAGAGGAGCTTCCACCCAGAGCAGGACGCCGGGAAGGTCTTCAAAGGG
CACAG
gtggggacgtgggaacggggcgggggctcccaggcacgtcctgtctggcacgtcccaggt
gacccctgtctgtctgtccaggaaccaggtgacttgcctgtcagtgtccactgacggcag
cgtgctgctctcaggctcccacgacgagaccgtgcgcctctgggacgtgcagagcaagca
EXON 7  125 bp
ggcctgcggctcacacacgtctcggccttcgcagcccggacagagggagaggagcttcca
cccagagcaggacgccgggaaggtcttcaaagggcacaggtggggacgtgggaacggggc
gggggctcccaggcacgtcctgtctggcacgtcccaggtgacccctgtctgtctgtccag
GAACCAGGTGACTTGCCTGTCAGTGTCCACTGACGGCAGCGTGCTGCTCTCAGGCTCCCA
CGACGAGACCGTGCGCCTCTGGGACGTGCAGAGCAAGCAGTGCATCCGGACGGTGGCCCT
CAAAG
gtgggcgcgcctctgctcggcccgcggccagcgcgcaggggaaaaagccagcaggagctc
cgggcttggcttgggtgggggcggggactggtttgctgtggggcggggccgggctggggg
cgtggactggctgtggggcggggcctggctgggggagtggactggctgtggggcgtgggc
EXON 8  167 bp
gggtggggcctggctgggggcgtggactggtcgtggggcggggcctggctgggggcgtgg
actggctgtggggcggggactggctgggggcggggactgccctggatggggcggaacttg
gcttgctgtggggtggggcctggctgggatggggcggggcctgacctccgcgccccccag
GCCCAGTCACCAATGCCGCCATCCTGCTGGCGCCCGTCAGCATGCTGAGCTCAGACTTCA
GGCCCAGCCTGCCGCTGCCCCACTTCAACAAGCACCTGCTGGGCGCCGAGCACGGGGACG
AGCCGCGCCACGGGGGCCTCACTCTGCGCCTGGGCCTCCACCAGCAG
gtacggcccccagcagggaacccccactgcccttttgtcccggaagaccccgcgggccct
gggctccttcgctcccttggtcctggcgcccgtgcggcggttccccacaagcccggcact
ggagggcgcgtcctgtgagtgggatggtgatgctcggtggggcctctgcccactctcagt
EXON 9  69 bp
ttgtcatctgcaggctcgacggaggtgaacgcccccgtctcagtcttcccttctgtctgt
gggcgtcacggtggcccctccctggctgagtggctgcccacgctggcgggggtgggatgg
gcaaagcgtgtggtgtgtgacaggacgcgccccgaggtcacgtggctccctgtgttacag
GGCTCGGAGCCCAGCTACCTGGACCGCACGGAGCAGCTGCAGGCCGTCCTGTGCAGCACC
ATGGAGAAG
gtgggcggggcctcgggaggggcggggcctgaggctggggtcagtcctggccagtggggg
tgagtggcccccctccagcacaccccaggccacttctgccctctgaccccgacttctccc
gcagagcgtgctcggcggccaggaccagctgcgcgtccgtgtgacggagctggaggacga
EXON 10  345 bp
gctacctggaccgcacggagcagctgcaggccgtcctgtgcagcaccatggagaaggtgg
gcggggcctcgggaggggcggggcctgaggctggggtcagtcctggccagtgggggtgag
tggcccccctccagcacaccccaggccacttctgccctctgaccccgacttctcccgcag
AGCGTGCTCGGCGGCCAGGACCAGCTGCGCGTCCGTGTGACGGAGCTGGAGGACGAGGTG
CGCAACCTGCGCAAGATCAATCGGGACCTGTTCGACTTCTCCACGCGCTTCATCACGCGG
CCGGCCAAGTGAGGCCCGGAGACCCCGGCCCGAGGCGCCCAGGCCTGAGCCCCATGCCTC
CCAGCAACCAGGGCCCGCGGGTGTGGCCCCCACCAGCCCAGGCCTGGACTCTCCTCAGTT
CTGTGTCGTGTTCGGGTTTTTCCTCTGTGACTGGGCCGTCTTGGTGTCTCGTGGCACGCG
TCACAGTGGTGCTAGTCTGTTTTTAACAAAAGAGGATGAAAAGCC
cctcctctccggcctccttgtgtccgggtgtggcctggtgctgcgtgcaacacagctccc
ctgctgctcggcccagctgggaccccagccccactcggcaccctctgtccggaggtgggg
gccttaaccaacctaggcctcgcgggggcggctttaagagggagccccgagcacctgcag