Gene UQCRFS1 Variant 1
DNA : 5.95 KbNT_011109
mRNA : 1202 bp NM_006003
CDS : 825 bp NP_005994
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  303 bp
gttcagccctctcgttcttctggggatctctcgggacactgacgaggtggcaccgggacc
tacaggtgggccgcaagccccgcccccagcgacggcttgtagccccgtcccccgacgcag
cgcctctccaagtttgccccgccctgcaggactgcagaatttcctttccggcggcgcgct
GTCGTCACGCGTCCCGCGCCTCCTCGCGCCTGCGCCGTGGTTGGAAGGTCGTCCCTGTGA
CCGGCTTGGCGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCATCCCGCTCAGGCCCGT
TCGCGCCCGTCCTGTCGGCCACGTCCCGCGGGGTGGCGGGCGCGCTGCGGCCCTTGGTGC
AGGCCACGGTGCCCGCCACCCCGGAGCAGCCTGTGTTGGACCTGAAGCGGCCCTTCCTCA
GCCGGGAGTCGCTGAGCGGCCAGGCCGTGCGCCGGCCTTTGGTCGCCTCCGTGGGCCTCA
ATG
gtgagccggggcgagggccgcgagcagggctgggggtctctcggtgcccgctcctccggc
ccccagcagggagcggccgcgggcgcgcgagcggagcctgaatcaggtcgggctgggcgg
cctccgcaactctgggcctggcccccgggctcggggcgtctttctggtggccggcctgga
EXON 2  899 bp
ttaagattttatatgctagcaccgccaatttgactatttctgagacccagtgagtgccat
atttcacatttttagaatttgattttttacctgtgaatccataaagggctatttcctgat
atatactcccttcgggatactcatctaattgtgttttttaaccttctgtttgtcttgcag
TCCCTGCTTCTGTTTGTTATTCCCACACAGACATCAAGGTGCCTGACTTCTCTGAATACC
GCCGCCTTGAAGTTTTAGATAGTACGAAGTCTTCAAGAGAAAGCAGCGAGGCTAGGAAAG
GTTTCTCCTATTTGGTAACTGGAGTAACTACTGTGGGTGTCGCATATGCTGCCAAGAATG
CCGTCACCCAGTTCGTTTCCAGCATGAGTGCTTCTGCTGATGTGTTGGCCCTGGCGAAAA
TCGAAATCAAGTTATCCGATATTCCAGAAGGCAAGAACATGGCTTTCAAATGGAGAGGCA
AACCCCTGTTTGTGCGTCATAGAACCCAGAAGGAAATTGAGCAGGAAGCTGCAGTTGAAT
TATCACAGTTGAGGGACCCACAGCATGATCTAGATCGAGTAAAGAAACCTGAATGGGTTA
TCCTGATAGGTGTTTGCACTCATCTTGGCTGTGTACCCATTGCAAATGCAGGAGATTTTG
GTGGTTATTACTGCCCTTGCCATGGGTCACACTATGATGCATCTGGCAGGATCAGATTGG
GTCCTGCTCCTCTCAACCTTGAAGTCCCCACGTATGAGTTCACCAGTGACGATATGGTGA
TTGTTGGTTAAGAGACTTGGACTCAAGTCATAGGCTTCTTTCAGTCTTTATGTCACCTCA
GGAGACTTATTTGAGAGGAAGCCTTCTGTACTTGAAGTTGATTTGAAATATGTAAGAATT
GATGATGTATTTGCAAACATTAATGTGAAATAAATTGAATTTAATGTTGAATACTTTCAG
GCATTCACTTAATAAAGACACTGTTAAGCACTGTTATGCTCAGTCATACACGCGAAAGGT
ACAATGTCTTTTAGCTAATTCTAATTAAAAATTACAGACTGGTGTACAAGATACTTGTG
aaatctgtaactgactttattttcttgcccaaatatttgcttcctgctttgcgtcaggga
cgcagattctgcacggtcattgttgggatgaagtaaaattaacgggtcatctaagtgtct
atggcattgacagaaacagtagtatctaggtattccttatttaccggacttggtaagagt