Gene TPM4 Variant 1
DNA : 26.08 KbNT_011295
mRNA : 2050 bp NM_003290
CDS : 747 bp NP_003281
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  183 bp
ctgtggccagcggtgccgacgtcaggccctcccccagcggtgctgacgtcggcggtccgg
ccgggtgacctcatcgccccgacggcagccggcccggggggcggggagaggcgggggcgg
cccccgcgcaggcaaaggcttggggggccggggcgcggctgtgcagctctcgccggagcc
GAGCCCAGCCGAGCGTCCGCCGCTGCCCGTGCGCCTCTGCGCCTCCGCGCCATGGCCGGC
CTCAACTCCCTGGAGGCGGTGAAACGCAAGATCCAGGCCCTGCAGCAGCAGGCGGACGAG
GCGGAAGACCGCGCGCAGGGCCTGCAGCGGGAGCTGGACGGCGAGCGCGAGCGGCGCGAG
AAA
gtgagcgccccggcctcgggccccgcacccgcagcctcctcccccgcgcgccctcctttc
ttcccggcttcccgcgctgcccgcccgcgcgcagtcctcgggccgcctttttacgccctc
ggacgccgatcgccgacccacatccctgcgcccgcagccaggaccccctacttcctccgc
EXON 2  134 bp
agacattttccgggaagatcatactgaaattttggtatgagtgtaaattccctatggcct
ggactcctgggtgggctttgacggggaagatcaggttaacagagggcaggacatggggga
ggctcccactggtggctggcctgatacttcttaacatggctgcacctccgacctccccag
GCTGAAGGTGATGTGGCCGCCCTCAACCGACGCATCCAGCTCGTTGAGGAGGAGTTGGAC
AGGGCTCAGGAACGACTGGCCACGGCCCTGCAGAAGCTGGAGGAGGCAGAAAAAGCTGCA
GATGAGAGTGAGAG
gtaaggacgctttgaatctggtggcatccgtgtttgcttttagaaaatggggatcatgct
gccgacctcgcagagctggtgtgaaagtaaacaaggtcacaaggacatgcatgtgtccac
aaaaaagtgcatgacagcactttgtaaaccatcactccatgggtagagatgtttatccgt
EXON 3  118 bp
aggaggctgaggcaggagaatcgcttgaacccgggaggtggaggttgcagtgagctgaga
tcgtgccactgcactccagcctggatgacagagcgagactccatctgaaagaaaagatag
atgagaggtgggtggaggggtgtgagtgaacggccgtcctgatgagattgctccttgcag
AGGAATGAAGGTGATAGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAGATTCAGGA
GATGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACGAGGAG
gtgagtggggctggcagatggcgcagcagcaggaagtgggaggaaatgcatctgctgaga
tagggaggacaccggggccaacgaaaggaagctctcggttaggtcagctgtcctcctgcg
tgaacatatgtttgtccagagacaaccacttggctaggaaactatctcccacgatgccag
EXON 4  71 bp
ctccagcctgggcaacagagggagactccgtccccctgcaaaaaaaagaaacaccagaaa
aacccatgttgcagctggtctaggggtctgggtggggcatcattgggggctgtctgcagt
ggatgggagaggacacggctggtggggatcgggctcagctgggcctttctgtctctgcag
GTAGCTCGTAAGCTGGTCATCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGCGGAG
GTGTCTGAACT
gtgagtggcagaacaggactgagcgaggctggctcgattcctggggcggagtgggaagga
gctggctgtgttgggaattggctctgaccggggtctctgctcaagtggacgggcgtcagg
ggctcatggctcatcttttctcttggcttctgtgacaaagaggtggtgacttgttcttac
EXON 5  76 bp
gataagcccatagtatcacactgcagaaaaatccattaacattttctccccacattcctt
ctgccccccaccgggggagctgtgtaggtttctcctttggaaaatttattgttggggcga
ttgctattattgccggctgtaagggaagataagacacaaaaatcctttgtctttgtgcag
AAAATGTGGTGACCTGGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGA
GGCTGCATCTGAAAAG
gtaggtggttggcttgagctggagggtggcttgctggactttgttcttttcttctcccga
gggatgcaggagcctgtcaggttatggggaatctgccctttatttaacagtagcgttggt
gcctggcagccagggtttttcccctacagaaagagctggatttctcctgcacactcttga
EXON 6  63 bp
tggctaatttttgtatttttagtagagacggggtttcaccatgttggccaggctggtctc
gaactcctgaccttgtgatccaccagcctcaggctcccaaagtgccaggattccaggcat
gagccaccatgcctggctgggcctccttttcttaaagcagtgttttggtttctcccacag
TATTCTGAAAAGGAGGACAAATATGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAA
GAG
gtgagtgtggtggcacccagcgagctctggtttctcctggggctggtcttgaagccatga
tagtaactcctttcttcttatctaggctgagacccgtgctgaatttgcagagagaacggt
tgcaaaactggaaaagacaattgatgacctggaaggtatgaggttaccatctaaatgttt
EXON 7  70 bp
ttcttaaagcagtgttttggtttctcccacagtattctgaaaaggaggacaaatatgaag
aagaaattaaacttctgtctgacaaactgaaagaggtgagtgtggtggcacccagcgagc
tctggtttctcctggggctggtcttgaagccatgatagtaactcctttcttcttatctag
GCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGAT
GACCTGGAAG
gtatgaggttaccatctaaatgtttgccttgccctgccttcccctctgggacacatccac
ggacagttggggaatgtttgtggaggggctgggttgggctttgtttgccttaggaaagta
aagcgcatagtgatgtcatatctggatgtcctggaacactggaataggataatgcaaagc
EXON 8  1335 bp
ttgcttgagcctggcaggtgaaggttgcagtgagccaagatcgcgccactgcactccagc
ctgggtgacagaatgagaccctgtctcaagaagaagaaaaaaaaacaaatcttttttttt
ctttcatttaacaaagacgcttattaatttatctttccccatactcttaatcctcaccag
AGAAACTTGCCCAGGCCAAAGAAGAGAACGTGGGCTTACATCAGACACTGGATCAGACAC
TAAACGAACTTAACTGTATATAAGCAAAACAGAAGAGTCTTGTTCCAACAGAAACTCTGG
AGCTCCGTGGGTCTTTCTCTTCTCTTGTAAGAAGTTCCTTTTGTTATTGCCATCTTCGCT
TTGCTGGAAATGTCAAGCAAATTATGAATACATGACCAAATATTTTGTATCGGAGAAGCT
TTGAGCACCAGTTAAATCTCATTCCTTCCCTTTTTTTTTCAAATGGCACCAGCTTTTTCA
GCTCTCTTATTTTTTCCTTAAGTAGCATTTATTCCTAAGGTAGGCAGGGTATTTCCTAGT
AAGCATACTTTCTTAAGACGGAGGCCATTTGGTTCCTGGGAGAATAGGCAGCCCCACACT
TTGAAGAATACAGACCCCAGTATCTAGTCGTGGATATAATTAAAACGCTGAAGACCATAA
CCTTTTGGGTCAACTGTTGGTCAAACTATAGGAGAGACCAGGGACCATCACATGGGTAGG
GATTTTCCATCCAGAGCCAATAAAAGGACTGGTGGGGGCCGGGGGTGGCTATTGTGGGAA
GTCATAACCCACAGATAGATCAACCTAAGAATCCTGGCCCTTCTCCACTCTCCACCATGC
AGGACAAACATCTTCTCAAGCAGTCAACGTAGAATGCTTGGGAAATAGTCATAATTACCC
ACATATAGTAATTAATAGATGGTAATTAATTGATCCTTGATGTGATGTTCTTTTGCATAT
TTCCTTCATTCTAAAGTTGTTCCCTGGCCGGGAGCGTTGGCTTTCGCCTGTAATCCCAAC
ACTTTGGGAGGCCAGGACAGATCACTTGAGGTCAGGAGTTCGAGACCAGCCCAGCCAACA
TGGCGAAACCATGTCTCTACTAAAAATACAAAAATTATGGTGACGCCTGCCTGTAGTCCC
AGCTACTCGGGAGGCTGAGGCAGGAGGATCGCTTGAACCCAGGAAGTGGAGACTGCAGTG
AGCCGATATCGCACCACAGCGCTCCAGCCTGGTCGACAGAGTGAGACTCCATCTCAAGAA
AAAATAAAAATAAAGTTGTTCTCTGAAGAGCAAATGTCTCATTCCAGTAATGACCCACTC
AGCAGGAATATGGTGGAGTTCAGTCCAATTCAGGTCAGCCATATCCAAAAGACCACAAGT
CATTACTAAGTTGAGCAAAAGAGTTTTTATCTATTAGCAGAAAGGGCCTCTCTGGCAGCA
GAGATTAAAAACTGGCCCAACTTCATTTCCATACTTCAGGGAACAGCAAATTGAGGATTT
ACTTATCTAGGACTT
gaattccttctttgggaccaagttaataaaagaccaagaaactcctgattaaactggata
atgaaggattctgtagacagggctgcacgtatcggctttgtttgacttctcttttctcag
ttaacatctcagagctagaacattccacattccccagcagcgtgtgggggctgactaaag