Gene THOP1 Variant 1
DNA : 28.09 KbNT_011255
mRNA : 2549 bp NM_003249
CDS : 2070 bp NP_003240
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  171 bp
gctctggaatggtagagcaagaggctccgcccacgcaccgccgagaccaataacggaccg
ggagggttacggcgagtgcgcagagggctccagcgcactcccggccctcctcctttagct
gtgggcggggctcaggggcgcgtgcgtcctgccctccctgtgcgcgcgccgccccagcat
GCCCCGGGAGCGCGGGCGGCGGGCCCCTTGGTCCTCAGGCGGCCGTGGCGGCGGTGGCGG
CGGTTGGGCCGAGGCAGGCGGCCTCAGTGGCCGAGGTGGCTGGACGCGTAGCAGGTGGAA
GGAGGGAGGGAGCCGCAGGCGCAGACCCACCCGCCATGAAGCCCCCCGCAG
gtaccgactaccccgctcgccggacccgggcgtcccctgcaccctcgctcctcccggggt
cgcgacttgggcctaaggctggagcgaagcgacccccgagccaccctcggccgggctgga
ggggcagcgggggaggtggacgaccctgctctctcgtttgccgaatgaatgaaccagctt
EXON 2  213 bp
atggcagagtagcctcctgctctagaggactggtcagtctgtgcttccctacaagagccc
tggacctcactcttctggatgagaagcgggtgatcccttcctttccctctgccctcctga
ctttgaccctaactgaaccgaaagcagacccgcccggcactgggttttgtttctgcgtag
CCTGTGCAGGAGACATGGCGGACGCAGCATCTCCGTGCTCTGTGGTAAACGACCTGCGGT
GGGACCTGAGTGCCCAGCAGATAGAGGAGCGCACCAGGGAGCTCATCGAGCAGACCAAGC
GCGTGTATGACCAGGTTGGCACCCAGGAGTTTGAGGACGTGTCCTACGAGAGCACGCTCA
AGGCGCTGGCCGATGTGGAGGTCACCTACACAG
gtaagtcccaggcagggtctgtgcgtgggccgcaggtgccgagggaggtggcaccgcagg
cgggagtagcccagcccgtggagccggttcagaacctggcttgaagtgtcaccagcaccc
tgcccctgagcacagggcagcgccacctgctcccaggctggtcgtggtggctaaatcaga
EXON 3  149 bp
gggcccagcctggaggggacggtggcgtgtgcctctagtcccagctacttgggaggctga
ggcaggagagagttcacggggggattcagcagacaggcctgggagaggggtccgggcaac
acctgccagttgtactggggcctgttctcacacctgtctccctggtctcccctgttttag
TTCAGAGGAATATCCTTGACTTCCCCCAGCATGTTTCCCCCTCCAAGGACATCCGGACAG
CCAGCACAGAGGCCGACAAGAAGCTCTCTGAGTTCGACGTGGAGATGAGCATGAGGGAGG
ACGTGTACCAGAGGATCGTGTGGCTCCAG
gtgagggggccctgcggggagtgcaaatagcctcccaagtaactaggattacaggcgccc
gccaccacacccggctaatttttgtatttttagtagagacggggtttcaacgtgttggtc
aggctagtctcgaactcctgacctcaagtgatccgcccacctcggcctcccacagtgctg
EXON 4  108 bp
cgaacgtttgcacaggttttatgtagagacaggtcgtcatttctctgagataaatgccca
ggagtgcagttgccaagtcacacgggggccggatgatcaggtttttaagaaactgccaaa
ctgctctttggagcggctgcactggcccacgtcctacatgctttgatgtttttattccag
GAGAAAGTTCAGAAGGACTCACTGAGGCCCGAGGCTGCGCGGTACCTGGAGCGGCTAATC
AAGCTGGGCCGGAGAAATGGGCTTCACCTCCCCAGAGAGACTCAGGAA
gtgagtgctgggtgtagggagtgctgggcgtgggcaatggtcgatcccggggagtgctgg
gcacagggagtgctcagtcccagggagtggtgggagcaagaagcgcagggcagggggagt
gctgggctcggggagtgctcggctcagggagtgcttggggcatcaggagtgctgggttca
EXON 5  103 bp
cctccgtgtctgtctgtcctccgcctcccgtctcactctttcctcctcggttgcctcttc
tttcggcctggttcttggggaaatccctcagccctcggcgagagggttcccaggcgttgc
gtctccccgcggagcccgccccggtctctccctcccctcacgccccgcctttctctccag
AACATCAAACGCATCAAGAAGAAGCTGAGCCTTCTGTGCATCGACTTCAACAAGAACCTG
AACGAGGACACGACCTTCCTGCCCTTCACGCTCCAGGAGCTAG
gtaggggccgagcagtggggcacgggtggccatcggtcctgggactcagtgcaggcctgc
caggccctcgggggccgccgcttcctcctgtgggcttctgtgctgaagggcggcgggagg
ccgaagtacgtggacctgaccgccctgggctgaggactttcctcaccggaagcgctccag
EXON 6  161 bp
tgatggggttagatgggggatgtaagaattgcagcgggtggtggccaggctgcagctgct
cgctgagggcccccttgtagctttccaggcagaggggaagcccaccccttccctcacacg
ctgtgtgcaggctgtgggcccatcagtcctgtcaaagccaccctggttctgtccccatag
GAGGGCTCCCCGAGGACTTTCTGAACTCCCTGGAGAAGATGGAGGACGGCAAGTTGAAGG
TCACCCTCAAGTACCCCCATTACTTCCCCCTCCTGAAGAAATGCCACGTGCCTGAGACCA
GGAGGAAAGTGGAGGAGGCCTTCAACTGCCGGTGCAAGGAG
gtgagaaggcacggccagggggccccagaacagtgggtctggagcttgtggggcccgtct
gctccatgtgtgtgaggcacctccaggctttgcacttggatggcctcccaatctccctgg
ccaggcccagtggccagcagaggcctccctgtggggctctgccgtgccctggaggtgtct
EXON 7  136 bp
gattatgataacgctggtggcatgaccagaggagttgtgtagtaacacaggccgagaggg
gcagggaccggaggtcagacggagctggatatgagcctttggccctgggacagggcgtgc
tggccctggaggtggagggagtggcgcccctgggtgacagtgtggtggtgtcggttgcag
GAGAACTGCGCTATCCTCAAGGAGCTGGTGACGCTGCGGGCCCAGAAGTCCCGCCTGCTG
GGGTTCCACACGCACGCCGACTATGTCCTGGAGATGAACATGGCCAAGACCAGCCAGACC
GTGGCCACCTTCCTAG
gtagcccttccttcctcctccactggggtccctgtggggaaggttctcagggtcacccca
ggggacagtcggtgctacccctagagccttgtcctttccctccatgaagagggacttctg
acgcctgccctggctccctcactccccccgagggacccttacagaacagggaagcgcccg
EXON 8  367 bp
cggccccgccgccccctcaccctgagcgtgaggatgctcggcccctcgaggggttgccgg
gaactgcgggtcctcccttccaaatggggagcctgacgaagtcgcggccgcgggcgggcg
agcccagagccatggaggagcccgcgaggcgagaggcccacctttctgccctccccgcag
ATGAGCTGGCGCAGAAGCTGAAGCCCCTGGGGGAGCAGGAGCGTGCGGTGATTCTGGAGC
TGAAGCGTGCGGAGTGCGAGCGCCGGGGCCTGCCCTTCGACGGCCGCATCCGTGCCTGGG
ACATGCGCTACTACATGAACCAGGTGGAGGAGACGCGCTACTGCGTGGACCAGAACCTGC
TCAAGGAGTACTTCCCCGTGCAGGTGGTCACGCACGGGCTGCTGGGCATCTACCAGGAGC
TCCTGGGGCTGGCCTTCCACCACGAGGAGGGCGCCAGTGCCTGGCATGAGGACGTGCGGC
TCTACACCGCGAGGGACGCGGCCTCGGGGGAGGTGGTCGGCAAGTTCTACCTGGACCTGT
ACCCGCG
gtgggtgagggcagcgggggcggggggcgcaccccggccctgggtctcctcggagcccgg
tgtgcccgtctgagatgggaaggaagtcgttgcctgctccatggggcctcggggatgaac
cccgagacgtagcacccgtgggcacaccacaggggccgaaaatgcagctgtccccgtttc
EXON 9  202 bp
gggcctggccgtggttttcatgctgccctgcgccaagccacctctgctgagagggaggtt
tagaacctcagaggtgcccggcggtctgggttagcagtcaggtgggctgagggatgcgga
gtcagggactcttgcggtgtctctagtccctgcggggcctgacgctgcctccctccccag
GGAAGGAAAGTACGGGCACGCGGCCTGCTTTGGCCTGCAGCCCGGCTGCCTGCGGCAGGA
TGGGAGCCGCCAGATCGCCATCGCGGCCATGGTGGCCAACTTCACCAAGCCCACAGCCGA
CGCGCCCTCGCTGCTGCAGCATGACGAGGTGGAGACCTACTTCCATGAGTTTGGCCACGT
GATGCACCAGCTCTGCTCCCAG
gtgggtgcgggcccgggcaggggcaggggcaggggcaggggcaggggctgcctgtggtca
gcgaggcccaagcctggggcttcggcttccggctctctctgcacccgtccggtggctcct
tcatccaatgccacccaaagatggtgactccctgtcatgcccgtgtcctggggctgcccc
EXON 10  187 bp
agcagcagcccaggggcctccgggtcccggtcgttttccagttttggggtgggagggccg
ggcccagcgcatcacctgtgcactcgccctgtttgcactgtggcagctgacacgggccag
gccggcgggaacgggctaggcaggacctgggcactctgaggctctgccccatccctgcag
GCGGAGTTCGCCATGTTCAGCGGGACCCACGTGGAGCGGGACTTTGTGGAGGCGCCGTCG
CAGATGCTGGAGAACTGGGTGTGGGAGCAGGAGCCGCTGCTGCGGATGTCGCGGCACTAC
CGCACAGGCAGCGCCGTGCCCCGGGAGCTCCTGGAGAAGCTCATTGAGTCCCGGCAGGCC
AACACAG
gtgcacccgccccgtccggggaagggtgctaacctcggggggcggcacacagctggggcc
tggcatgtgccccgggtgggggtcggagctctgggcagagtgggccggggcaggtgcaga
ggccagctctctccttccctcccgcccaggcctcttcaacctgcgccagatcgtcctcgc
EXON 11  129 bp
aagctcattgagtcccggcaggccaacacaggtgcacccgccccgtccggggaagggtgc
taacctcggggggcggcacacagctggggcctggcatgtgccccgggtgggggtcggagc
tctgggcagagtgggccggggcaggtgcagaggccagctctctccttccctcccgcccag
GCCTCTTCAACCTGCGCCAGATCGTCCTCGCCAAGGTGGACCAGGCCCTGCACACGCAGA
CGGACGCAGACCCCGCCGAGGAGTATGCGCGGCTCTGCCAGGAGATCCTCGGGGTCCCGG
CCACGCCAG
gtagccacccttgagccgggcacaccctggaatttggagcctcagctgcttccctgggaa
ggtgaagggagttggtccccatgcttcacttagcaagtgcaggagtccctgctggggagc
cacggagcgcgtcccaggctcctcgggggacagccccagctgagatgcagctgcaggccc
EXON 12  137 bp
ccctcgctttgtggctgactctggttctagaagtatccagctggtctcggccctcaccgt
gatcctccagcttctccctgttccgggcaggggtctcaggagtctggctggttgtcttct
cctggaggaggagcatggggtgggggctacagcgtgaaccctgccatgtgtccgccccag
GAACCAACATGCCTGCAACCTTCGGCCATCTGGCAGGTGGCTACGACGCCCAGTACTACG
GGTACCTGTGGAGCGAGGTGTATTCCATGGACATGTTCCACACGCGCTTCAAGCAGGAGG
GTGTCCTGAACAGCAAG
gtacgcggggactggggacagggagggcgtcctgaacggcaaggtacgcggggactgggg
acagggagggcgtcctgaatggcaaggtacgcggggactggggacagggagggcgtcctg
aacggcaaggtacgcggggactggggacagggagggcgtcctcaacagcagggtggggcc
EXON 13  486 bp
ttctgatgaaaggcacctgcgctctcccacctgtgctgatgcaggcggcccccgggcctc
cctgggaacctggaaggggttgctccgaggcccccctgggcgagggtgtgcagactcctg
gggtcctctgccttcctccctgggtccccacccggccacagtgccctgtctcctcggcag
GTTGGCATGGATTACAGAAGCTGCATCCTGAGACCCGGCGGTTCCGAGGATGCCAGCGCC
ATGCTGAGGCGCTTCCTGGGCCGTGACCCCAAGCAGGACGCCTTCCTCCTGAGCAAGGGG
CTGCAGGTCGGGGGCTGCGAGCCCGAGCCGCAGGTCTGCTGAGGCCTGGCACTGCGACTG
CCCAGTCTGGCCTGCGCTCCCGCCGCCCTGGTGCCTTAGCCCCCGGCACAGGATGGGGCA
GGCTCTGGCACAGTGCCTGGGACTGGCAGGGTGGCTGAGCGGCTGTCTTGCCTCTTGTCA
TTGTCTGTCCCCACCCGGTCGTGGCCCACCCGGCTAGAGACGGCGTCCTCAAGGCATCTG
GAGGGCTTTCGTGGCTGCCAGGGCCTGGTCTTTGTTGCACTAACACGTCTCCTCTCTGGG
AAACGTCCCTTGTCAGGAGACGGCTCTTCTTTGAAATGAGGTCATTAAAAGGAAACAGAA
AAAGAG
agaggctccctggcctggtcactggctcctgcgcttttttggtccgaggacggtgggacg
gcgggtcagggtccagccctcgggctgttgccacaccaggccctggattggggctcaggt
ccttgtgggggcggggggtgggggagtaaagggctgggaaccagttctgccagccaggcc