Gene RPS9 Variant 1
DNA : 6.50 KbNT_011109
mRNA : 691 bp NM_001013
CDS : 585 bp NP_001004
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  131 bp
agacgttaggaaacagagcagggtggttgaacgggagtgcagcacggttgtgggggcaga
tactgactatgagagcgttggaggttattctcgcgagatcggatctgggctccgcgaggt
tttggcgtagttgtgggactgcgcaggcgccgtttggagcccttacgctcacacttctct
CCCGCGCAGGCGCAGACGGGGAAGCGGAGCCAACATGCCAGTGGCCCGGAGCTGGGTTTG
TCGCAAAACTTATGTGACCCCGCGGAGACCCTTCGAGAAATCTCGTCTCGACCAAGAGCT
GAAGCTGATCG
gtgagtggccaaggcttccgggaagtggttcggcttccgggaggcggttagcacgtggat
gaaggtgcccatgtactctatctagtccgtcccctaaatttggtactattcgtggtttag
gaaggttttgtgattccaaagctgccagtctagttgttgtgccagtacgtgggactacac
EXON 2  123 bp
tggttcggcttccgggaggcggttagcacgtggatgaaggtgcccatgtactctatctag
tccgtcccctaaatttggtactattcgtggtttaggaaggttttgtgattccaaagctgc
cagtctagttgttgtgccagtacgtgggactacacttgtccacccccttctccccaccag
GCGAGTATGGGCTCCGGAACAAACGTGAGGTCTGGAGGGTCAAATTTACCCTGGCCAAGA
TCCGCAAGGCCGCCCGGGAACTGCTGACGCTTGATGAGAAGGACCCACGGCGTCTGTTCG
AAG
gtgcgtatgggagtccacagcagagggatggggtgcagggcttgtgaggttcattctccc
ttctgttgcctctgttccagtgatgagagttgtgtcattggataaatggaaccagccttc
taacttttagtggcacttgtgaagtaggaaaagtgtatctggatcagtctttgccctgtt
EXON 3  187 bp
gtgagccaccactcccagcccgtagggtggttttgacagtgacatgggtcacggtgatgg
cgctgtactacttgtgcctcaccgccgcggcatggagctaccaagaggcggagccaggat
ttgaacccaagaagcctgaggtcagaaggcggaatcagtgtttcctcccactcttcccag
GCAACGCCCTGCTGCGGCGGCTGGTCCGCATTGGGGTGCTGGATGAGGGCAAGATGAAGC
TGGATTACATCCTGGGCCTGAAGATAGAGGATTTCTTAGAGAGACGCCTGCAGACCCAGG
TCTTCAAGCTGGGCTTGGCCAAGTCCATCCACCACGCTCGCGTGCTGATCCGCCAGCGCC
ATATCAG
gtaccacctcggatgggcacctgaatcttcctccacctgcccctctgatggttgccctca
ctaagcctgctgtccctatctcctatgcagccctcggaggtgatgggtgtgaactcaccc
agagggtacagattcacccttgcacacagctcaccagggagctggggcagcctcttgccc
EXON 4  250 bp
taaggtgataccctaaaaccccggagggcgcacgtaggatcaggtgcacccttcctgcag
cgccttggtgtctgcagccgtggcggcctcacggggtgggtggagaggaaagagtggtgc
ggtagctggggttagcgtccgtttctcctccagtccacctcaccttgtcgcttcttccag
GGTCCGCAAGCAGGTGGTGAACATCCCGTCCTTCATTGTCCGCCTGGATTCCCAGAAGCA
CATCGACTTCTCTCTGCGCTCTCCCTACGGGGGTGGCCGCCCGGGCCGCGTGAAGAGGAA
GAATGCCAAGAAGGGCCAGGGTGGGGCTGGGGCTGGAGACGACGAGGAGGAGGATTAAGT
CCACCTGTCCCTCCTGGGCTGCTGGATTGTCTCGTTTTCCTGCCAAATAAACAGGATCAG
CGCTTTACAA
ttggtgtgtgggggtctctcatccttgactctttcccctgctctaaacatgcagccttcc
ctgggaggctcactcacttgggagtgcctaccagctagtggtccctggcctctcagtact
attctacagtagtgaacacacatctttaccagaaacttctgtcatcaggggagagacgag