Gene RAD23A Variant 1
DNA : 7.80 KbNT_011295
mRNA : 1793 bp NM_005053
CDS : 1092 bp NP_005044
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  181 bp
aacgggcatggcgtcactcaggagaccacgtgtgcgggccgagcaagaagccccgcccac
agcgcggagtttagtctgcgcgtgcctcgctcgagaacgcgctcgtgcgcatgcccacaa
aggccaaggagggagtgcgcaggtcacgtgcgccggtggtcagcgcgcgcattgcctgcc
CCGGAAGTGGTCGGCGCGCGGCGCGGCGCGCCTGGGCGCTAAGATGGCGGCGGCGTGAGT
TGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCAC
CATCACGCTCAAAACGCTGCAGCAGCAGACCTTCAAGATCCGCATGGAGCCTGACGAGAC
G
gtgcgggccgggccggagcccgggggcgggagcgacgggtttcgggggtggggtgggggc
ggggaggctagaatcccaacgggaggggcagggaggacggcgcgggtcggccctgcccag
acccccgacctgcccgactttcctggaccccccgatggtctttggcccagcccccagccg
EXON 2  162 bp
gtgttgaatggcatgatgattgaatgaattcaaatctagcatgctttagatgctgagaaa
gcttaaaaaacccagcgtgcttgcctttctgccatcagggctggcagtttctctgtccta
aactagaagggaaaagagaatcttggggtctccagtgactgtctgtaccactccctctag
GTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGTCGTGATGCCTTCCCCGTGGCT
GGACAGAAACTCATCTATGCCGGCAAGATCTTGAGTGACGATGTCCCTATCAGGGACTAT
CGCATCGATGAGAAGAACTTTGTGGTCGTCATGGTGACCAAG
gtgggtgacgtgtgctggctgggagggtgggtggacgagctggggagctggcaaagagcc
tgtgtgcccaggagagattagctgtgaacagggcggggccacagcggagcgggttgttgg
gtctgatagggttgctgatgccagctccctttttcttgctgttgcagaccaaagccggcc
EXON 3  182 bp
catggtgaccaaggtgggtgacgtgtgctggctgggagggtgggtggacgagctggggag
ctggcaaagagcctgtgtgcccaggagagattagctgtgaacagggcggggccacagcgg
agcgggttgttgggtctgatagggttgctgatgccagctccctttttcttgctgttgcag
ACCAAAGCCGGCCAGGGTACCTCAGCACCCCCAGAGGCCTCACCCACAGCTGCCCCAGAG
TCCTCTACATCCTTCCCGCCTGCCCCCACCTCAGGCATGTCCCATCCCCCACCTGCCGCC
AGAGAGGACAAGAGCCCATCAGAGGAATCCGCCCCCACGACGTCCCCAGAGTCTGTGTCA
GG
gtaaggcgggggcagcagtcccagcttgggccctgtcctcctagcacattccagcgtcca
cataagtggtcccacacacctggagggagggcaagccgccagaagccagggtccgatttc
tctctcttgaatttgcagctctgttccctcttcaggtagcagcgggcgagaggaagacgc
EXON 4  56 bp
agaggaatccgcccccacgacgtccccagagtctgtgtcagggtaaggcgggggcagcag
tcccagcttgggccctgtcctcctagcacattccagcgtccacataagtggtcccacaca
cctggagggagggcaagccgccagaagccagggtccgatttctctctcttgaatttgcag
CTCTGTTCCCTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACGCTAG
gtgggtgggtggtccccagggcagaggtgactgggtgccccagccatcagctgggccttg
tctgggtgcgggagggcctgggagctgccctttcctcttcctggtgacctaggctttgct
gcttcctccacagtgacgggctctgagtatgagacgatgctgacggagatcatgtccatg
EXON 5  128 bp
ctcttcaggtagcagcgggcgagaggaagacgcggcctccacgctaggtgggtgggtggt
ccccagggcagaggtgactgggtgccccagccatcagctgggccttgtctgggtgcggga
gggcctgggagctgccctttcctcttcctggtgacctaggctttgctgcttcctccacag
TGACGGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGAG
AGCGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATC
TGCTCACG
gtgaggtggggcttccgcctcccggggaggccttgagggagtacccgggcgtcactgccc
tgatgggcggttgggaaggcaaaacctgccctgaaaagcctttgggtagtgattctagcc
actaaaggcttcccacaggaggctggatgtgagtgatgggtgggcctctggagggcaggg
EXON 6  79 bp
gccctgaaaagcctttgggtagtgattctagccactaaaggcttcccacaggaggctgga
tgtgagtgatgggtgggcctctggagggcagggccgaggcctcatctgtgtcctgccagg
gcatggaggagggtggcagcaggaggtctgtgcattagaactaaacaggacccctgacag
GGAATTCCTGGGAGCCCCGAGCCGGAACACGGTTCTGTCCAGGAGAGCCAGGTATCGGAG
CAGCCGGCCACGGAAGCAG
gtgggtgtgcacatgccgcatctgccctccaggtacctgactcacattacactccacccc
gcagtgctcctaggagcccggcgtggtgtctgactgcaccccttcctactaccagcagga
gagaaccccctggagttcctgcgggaccagccccagttccagaacatgcggcaggtgatt
EXON 7  134 bp
ccccgagccggaacacggttctgtccaggagagccaggtatcggagcagccggccacgga
agcaggtgggtgtgcacatgccgcatctgccctccaggtacctgactcacattacactcc
accccgcagtgctcctaggagcccggcgtggtgtctgactgcaccccttcctactaccag
CAGGAGAGAACCCCCTGGAGTTCCTGCGGGACCAGCCCCAGTTCCAGAACATGCGGCAGG
TGATTCAGCAGAACCCTGCGCTGCTGCCCGCCCTGCTCCAGCAGCTGGGCCAGGAGAACC
CTCAGCTTTTACAG
gtgtggtcccaagggcagagggagctagggcagccaccatttcccttccctgtgggcacc
agagtccataacacgtaggaatcgttctaggtccggaaagcaggactaagcacatgcttc
ccccacgcccctgtgcttcctgtgacctggtgacccccctggtttctcagtcttcccaac
EXON 8  165 bp
aaaagcacatcatcagctcttccagggtagggcttgtgtcgactgctatgttgtgtttgg
ccagaacaggctcctctggatatttgcctgactgaatgaaaaagcaagggctgtgatgac
ctggggagaggaggggaccagggctgtgaattaccttcccttccccaccctctcctgcag
CAAATCAGCCGGCACCAGGAGCAGTTCATCCAGATGCTGAACGAGCCCCCTGGGGAGCTG
GCGGACATCTCAGATGTGGAGGGGGAGGTGGGCGCCATAGGAGAGGAGGCCCCGCAGATG
AACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCTATAGAGAGG
gtaagaggcctggctgaggggtgactgcaggtgggcaggacccctaccctctcctgctca
cacttaacctatcttcccacagttgaaggccctgggcttcccagagagcctggtcatcca
ggcctatttcgcgtgtgaaaaaaatgagaacttggctgccaacttcctcctgagtcagaa
EXON 9  706 bp
tctcagatgtggagggggaggtgggcgccataggagaggaggccccgcagatgaactaca
tccaggtgacgccgcaggagaaagaagctatagagagggtaagaggcctggctgaggggt
gactgcaggtgggcaggacccctaccctctcctgctcacacttaacctatcttcccacag
TTGAAGGCCCTGGGCTTCCCAGAGAGCCTGGTCATCCAGGCCTATTTCGCGTGTGAAAAA
AATGAGAACTTGGCTGCCAACTTCCTCCTGAGTCAGAACTTTGATGACGAGTGATGCCAG
GAAGCCAGGCCACCGAAGCCCCCACCCTACCCTTATTCCATGAAAGTTTTATAAAAGAAA
AAATATATATATATTCATGTTTATTTAAGAAATGGAAAAAAAAATCAAAAATCTTAAAAA
AACAAGCAAACAGTCCAGCTTCCTGTCCTCCTAAAGTGGCCCCTGTTCCCATCTCCCGGG
CCAGACAGCTGTCCCCCCGTCCTCCTCCCCAGCCCAGCCTGCTCAGAGAAGCTGGCAGGA
CTGGGAGGCGACAGATGGGCCCCTCTTGGCCTCTGTCCCAGCTCTCTGCAGCCAGACGGA
AAGGCGGCTGCTTGCCTCTCCATCCTCCGAAAAACCCCTGAGGACCCCCCCCCATCCTCT
TCTAGGATGAGGGGAAGCTGGAGCCCCAACTTTGATCCTCCATTGGAGTGGCCCAAATCT
TTCCATCTAGGGCAAGTCCTGAAAGGCCCAAGGCCCCCTCCCCAGTCTGGCCTTGGCCTC
CAGCCTGGAGAAGGGCTAACATCAGCTCATTGTCAAGGCCACCCCCACCCCAGAACAGAA
CCGTGTCTCTGATAAAGGTTTTGAAGTGAATAAAGTTTTAAAAACT
agccctatggtctgtgcctgctggggctccccgcgcccacctgtctgggtcttggggggc
tggctgggcacaggcaggcatggtgacgggtgcctggaagggggagaggagtctgtgagt
ccctgcagattgaggcttccggtgtctcctcccccagtgtgtcatttccaggcagtggac