Gene PTPRS Variant 2
DNA : 80.02 KbNT_011255
mRNA : 6385 bp NM_130854
CDS : 5733 bp NP_570924
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  339 bp
agggagctttctgggagatcctttatgacactaatcccgttcatgaggtctctgctctca
tgacctagtcacttcccaaacactccatctcctgttaccatcatagtggggactaggttt
caacatatgattttttgtgggggagacaccttaattctatagcaagggcccagcactttc
ATTCCATCCCATCACCCCATGATCCTTCCCCATTGTCCCATGACCAGCCCCCGCAGGACC
CTCCCCTGCTCCATGTGACCCTCCCTCTGCCTCCTCCATGAAGGTCTCCTGGATTTCCCC
ACTCGCCTCTCACAGCCCTCCATTGTCTCTGCAGACGTTGCCCCATCTGACGCTCGGCTC
GAGGCCTCTCTGTGAGGGACCGGGGGGCCATCCCCCTCCAGGGCGGAGATCGGAGGTCGC
TGCCAAGCATGGCGCCCACCTGGGGCCCTGGCATGGTGTCTGTGGTTGGTCCCATGGGCC
TCCTTGTGGTCCTGCTCGTTGGAGGCTGTGCAGCAGAAG
gtaagaagccggcacgggatgtgcaggggtctgcgtgtttgtttacctgtgtgcatttat
ggctgtgtgtgtgtgggcacactccccacctcctccctggggccctccattttgccaaat
ggaacttttatgctccacaaatgaggctgaatgctgaggactgtgtgctgagccctaaga
EXON 2  146 bp
gtggtggggggcgaggtgggagggtgtttgttgtcatccttgctttcctcctcctctctt
cattggccacatggcacttccgtgggcagggcatggaatgcaggttttcgtggctccttg
gtatcctagccagatgcctggacccatcagcgcccccccttctttccactgtatccccag
AGCCCCCCAGGTTTATCAAAGAACCCAAGGACCAGATCGGCGTGTCGGGGGGTGTGGCCT
CTTTCGTGTGTCAGGCCACGGGTGACCCCAAGCCACGAGTGACCTGGAACAAGAAGGGCA
AGAAGGTCAACTCTCAGCGCTTTGAG
gtgagttggggtagggggaggcagcctggggtcaatgctcccccaaggcagggccacagc
acctcagccacagtggacttcgtggacacgttccccaggtggagcatcatctgtggccaa
gcaagcatggctgcgcagcctccagccagggccctgcccgccttacttgctctaccagct
EXON 3  142 bp
cggcgcatttatactggacaccgacacacgtgcacattcagcctgcagcaattctcccag
tcacccccaggatcatggggctgactgccattcccctacagcccagcctagcccagccta
gacaggaaccttcctgggaccccagcctcactctgttcttttttcccctgcccatggcag
ACGATTGAGTTTGATGAGAGTGCAGGGGCAGTGCTGAGGATCCAGCCGCTGAGGACACCG
CGGGATGAAAACGTGTACGAGTGTGTGGCCCAGAACTCGGTTGGGGAGATCACAGTCCAT
GCCAAGCTTACTGTCCTCCGAG
gtattgggctcctcagggcgggcggaggataaactgggccctgggctttggggacaagca
caaaaggaatacatgaaagttaccccaaaccctcctgctttgtgttttttgggaggacct
tgatctcccttatccaaccagtaacagtctcagggcccagcgcctactggtggggattta
EXON 4  189 bp
gagcaagaccctgtctcaaaaaaagagagagaactggctgtaaaggatggcacccatggc
tgaggtcacgcagccagggaggagctggacccgtggccaggcagtccctgagccccaggc
tcaggagtggctgtgcagtgctcagaaccatgcccatttctctcacgtctctgccctcag
AGGACCAGCTGCCCTCTGGCTTCCCCAACATCGACATGGGCCCACAGTTGAAGGTGGTGG
AGCGGACACGGACAGCCACCATGCTCTGTGCAGCCAGCGGCAACCCTGACCCTGAGATCA
CCTGGTTCAAGGACTTCCTGCCTGTGGATCCTAGTGCCAGCAATGGACGCATCAAACAGC
TGCGATCAG
gtgagtgagggtggctgacaggacgtgggagccttggagggcagcagggggtggggagca
tctccagggcccaagttctggggactactggaggacagacagagacagtgtgtggccgtg
gcaggcgttggctctgggggagtgggggcaaatgtcttcaaagccgcacactgaggatat
EXON 5  111 bp
ggggtggaggttatacaaggcctggccaagctagggcttccaggttttctcacctcttat
ctgcctctctggcccagccagcacaggagacaggccagagagcactctggtgggggagct
ttccctgttcactcctgggcccccctctaacagaccaagctttttcccatcttcccacag
GAGCCCTGCAGATTGAAAGCAGTGAGGAAACCGACCAGGGCAAATATGAGTGTGTGGCCA
CCAACAGCGCCGGCGTGCGCTACTCCTCACCTGCCAACCTCTACGTGCGAG
gtagggaacgccgcgtccaggtcaaaggcagggacccgccccgtcccatccccctccctc
ctcgggctcaccgcctccgggctcccccgtcccctgcacacccaagcaggaaggcccctc
cccggtcgcggtgggaccttggccgaggcggcgtccctctctgggccttagtttccttgc
EXON 6  270 bp
gaaccagccctgtttatatttaaatggttttcctttttttttctttttttctttctttcc
ttctttctttcttccttcctgcttttctttttctcctccgcatcctgtcttcccctccca
acctcaccccacctcacccctcgcatctccctcccgccgccactgccgccccctccccag
TCCGCCGCGTGGCCCCGCGCTTCTCCATCCTGCCCATGAGCCACGAGATCATGCCAGGGG
GCAACGTGAACATCACCTGCGTGGCCGTGGGCTCGCCCATGCCATACGTGAAGTGGATGC
AGGGGGCCGAGGACCTGACCCCCGAGGATGACATGCCCGTGGGTCGGAACGTGCTGGAAC
TCACAGATGTCAAGGACTCGGCCAACTACACCTGCGTGGCCATGTCCAGCCTGGGCGTCA
TTGAGGCGGTTGCTCAGATCACGGTGAAAT
gtgagcagggcccatggggctcgtaggtggaggggcaggctggagtcgatccccgacttc
aggcacaggtgggaggcagcgtgggagcacctccgagttaccctcttggcttcagtcatt
catggctaggaaggggacggttgttctttgaacaggtattatttattggttataaatgat
EXON 7  582 bp
ggaccctgggccatagtttgttaccccttgctgtagacgatgacaggagtcatgaggccc
atgattactgctgggcaaatcaaggctcagagaaggcgactgaatggtgaaaagtcacac
agccttcagggtcctcaaccaatgtgcccaatgcgtgacacagctgcctcctgcccacag
CTCTCCCCAAAGCTCCCGGGACTCCCATGGTGACTGAGAACACAGCCACCAGCATCACCA
TCACGTGGGACTCGGGCAACCCAGATCCTGTGTCCTATTACGTCATCGAATATAAATCCA
AGAGCCAAGACGGGCCGTATCAGATTAAAGAGGACATCACCACCACACGTTACAGCATCG
GCGGCCTGAGCCCCAACTCGGAGTACGAGATCTGGGTGTCGGCCGTCAACTCCATCGGCC
AGGGGCCCCCCAGCGAGTCCGTGGTCACCCGCACAGGCGAGCAGGCCCCGGCCAGCGCGC
CGCGGAACGTGCAAGCCCGGATGCTCAGCGCGACCACCATGATTGTGCAGTGGGAGGAGC
CGGTGGAGCCCAACGGCCTGATCCGCGGCTACCGCGTCTACTACACCATGGAACCGGAGC
ACCCCGTGGGCAACTGGCAGAAGCACAACGTGGACGACAGCCTGCTGACCACCGTGGGCA
GCCTGCTGGAGGACGAGACCTACACCGTGCGGGTGCTCGCCTTCACCTCCGTCGGCGACG
GGCCCCTCTCGGACCCCATCCAGGTCAAGACGCAGCAGGGAG
gtgaggcgtggggtcggcaggactcggggccccggccgtgcggcttggttctttgcatgc
tccctggaagccgcagagcggtttgtgggttatgcacggtgctttaagatattttcatgc
tagcatttaggccgggtgtggtggtttacgcctgtaatctcagtactttgggaggccaag
EXON 8  134 bp
ggatggaggaacagaggtggacaggtgacaatgggatgggggcgaggtccccaggaaaat
aaaagaacattctagaagcacccagagctggcatcttttagtggggacactcagcaggtg
gggccccctttgtggggtggacgctccccgactcctagttgtctccctgcacccccacag
TGCCGGGCCAGCCCATGAACCTGCGGGCCGAGGCCAGGTCGGAGACCAGCATCACGCTGT
CCTGGAGCCCCCCGCGGCAGGAGAGTATCATCAAGTACGAGCTCCTCTTCCGGGAAGGCG
ACCATGGCCGGGAG
gtgaggcagcgcggggacgggctggcctgccctgggctcctccccggcgctctctgacgc
tgcccgccttgtctcttccccctctttgtccctatgtgtgctgcggattctgctcttcct
caccccttctgcttctcctgcgtctctgtccctttgtgcctttcctccacttttttctcc
EXON 9  145 bp
ctctccctcatccctctctgtccctctctgccgcacccctgtctctatttctctgtctct
ctctctctctctctctctccccctcccccctctgtttctgtctctctctctctccccttt
gtttctgtctctctctctctctcccccatccctctctgtccttctctgccctgcccccag
GTGGGAAGGACCTTCGACCCGACGACTTCCTACGTGGTGGAGGACCTGAAGCCCAACACG
GAGTACGCCTTCCGCCTGGCGGCCCGCTCGCCGCAGGGCCTGGGCGCCTTCACCCCCGTG
GTGCGGCAGCGCACGCTGCAGTCCA
gtaggtgtctcgcggggccgcccttctctgcgggagggaccacggcctgaccgcagacag
cccctcggcagacggacccaggcggggcctgctgcagtgggtggggggcgcctcccggcc
tgtctccgctttgttccccgacctcggatccatctacccgcgctgtgcctcagtatcccc
EXON 10  306 bp
catcccacctttggttgacacccacttcttttgggttcgacttctctttggtttggttct
gttttgtttgttatcatcttcttttttattttctctttcccatcttttgtttccccgccc
ccctccccacccatcccacctcccttccccacccccccacgttctccccccctccaatag
AACCGTCAGCCCCCCCTCAAGACGTTAAATGTGTCAGCGTGCGCTCCACGGCCATTTTGG
TAAGTTGGCGCCCGCCGCCGCCGGAAACGCACAACGGGGCCCTGGTGGGCTACAGCGTCC
GCTACCGACCGCTGGGCTCAGAGGACCCGGAACCCAAGGAGGTGAACGGCATCCCCCCGA
CCACCACTCAGATCCTGCTGGAGGCCTTGGAGAAGTGGACCCAGTACCGCATCACGACTG
TCGCTCACACAGAGGTGGGACCAGGGCCCGAGAGCTCGCCCGTGGTCGTCCGCACCGACG
AGGATG
gtaagtacctgccccaggcccgggaccccccgcaggccccagcccggcccccgcctcgaa
gccttccatctggaaacctgggctggtggtcaaagggcggaagcctcactcggaggaagt
cgggaagcaagcagcctccccgagaaatccggggctccttgactttggaattggcgattc
EXON 11  194 bp
gggctgtggggggtgtgcaggaggccatgtcctcccgcccggtggtgagcgctaagagcg
cccagttattcaccggcagccactcggcatcctggaatcggacagtggcactgcccgggg
cagggccgggcgccctggtaacggctccgcccgcccctcccctcccctcccgcccgccag
TGCCCAGCGCGCCGCCGCGGAAGGTGGAGGCGGAGGCGCTCAACGCCACGGCCATCCGCG
TGCTGTGGCGCTCGCCCGCGCCCGGCCGGCAGCACGGCCAGATCCGCGGCTACCAGGTCC
ACTACGTGCGCATGGAGGGCGCCGAGGCCCGCGGGCCGCCGCGCATCAAGGACGTCATGC
TGGCCGATGCCCAG
gtgggcggggggccggggcggggccggggacgggctccgggcggggacgggcccttgcgc
tccccccacctctgcttctctttctccatctctggcctcccccgctcaccttcctcctct
ctcccctgccgcctcctcccgcgctcagtgggagacggatgacacggccgaatatgtaag
EXON 12  118 bp
gcatgtaccctctgagcatggccatgccacgtgtcgtggtctctgcatgagctcatgtgc
acgtctccacccctgatccgggccctgcatcctccttgcttgttctcagcacggggagtg
ggggtgggtggggctgctcccagccccagccgtcgtgctgacccccagccgtgcctgcag
GAGATGGTCATCACAAACTTGCAGCCTGAGACCGCGTACTCCATCACGGTAGCCGCCTAC
ACCATGAAGGGCGATGGCGCTCGCAGCAAACCCAAGGTGGTTGTGACCAAGGGAGCAG
gtatgcaacccgccctcctcccacccaccaacagcccctttgcccccactggcaccagag
cgtgactccagagtccttgagctcacaagggcaggcagagggtgcaccaggcagctggaa
cagtgagacaaaggtgtgagggctgctcaggtgggtgtccagggcccagcttggcccccc
EXON 13  609 bp
tcgaggctgcagtgagccgtgatctcaccattgcactccaggctgggcaacagagtaaga
ccccccccaactcaaaaaaatgttatattgaaggaaaagaattaaaaatacaaccccacc
ttgtgcctctgggctggcggatggcgctgggaccctgacacctgccccgtatccccgcag
TGCTGGGCCGCCCAACCCTGTCGGTGCAGCAGACCCCCGAGGGCAGCCTGCTGGCACGCT
GGGAGCCCCCGGCTGGCACCGCGGAGGACCAGGTGCTGGGCTACCGCCTGCAGTTTGGCC
GTGAGGACTCGACGCCCCTGGCCACCCTGGAGTTCCCGCCCTCCGAGGACCGCTACACGG
CATCAGGCGTGCACAAGGGGGCCACGTATGTGTTCCGGCTTGCGGCCCGGAGCCGCGGCG
GCCTGGGCGAGGAGGCAGCCGAGGTCCTGAGCATCCCGGAGGACACGCCCCGTGGCCACC
CGCAGATTCTGGAGGCGGCCGGCAACGCCTCGGCCGGGACCGTCCTTCTCCGCTGGCTGC
CACCCGTGCCCGCCGAGCGCAACGGGGCCATCGTCAAATACACGGTGGCCGTGCGGGAGG
CCGGTGCCCTGGGCCCTGCCCGAGAGACTGAGCTGCCGGCAGCGGCTGAGCCGGGCGCGG
AGAACGCGCTCACGCTGCAGGGCCTGAAGCCCGACACGGCCTATGACCTCCAAGTGCGAG
CCCACACGCGCCGGGGCCCTGGCCCCTTCAGCCCCCCCGTCCGCTACCGGACGTTCCTGC
GGGACCAAG
gtaggcgcgcggcgacccctgcaccagagccggaccgggccttgcgcccacccccacccc
agccccctccctctcccctgcccaggtaagtgctcacttttctgcttcctcgtggtcact
caaggcaagtccggaccccgaggctccggcgttggcaaaggtgggacgtgcctcggtggc
EXON 14  98 bp
acttgggacaggacagggcagggccgggccagggccaggcaggaaggccgtgggcatggg
cacagcggacgacagggagcgcctgggccgccccaccccaccccgcttcacgccacccag
tgccaggcactcatggggcctctcttctgctctctccctgctcggccgcctccccggcag
TCTCGCCCAAGAACTTCAAGGTGAAAATGATCATGAAGACATCAGTTCTGCTCAGCTGGG
AGTTCCCTGACAACTACAACTCACCCACACCCTACAAG
gtgcgactgcccagccagcaggcaggcaggcaggcagggtcaggggttgtagttcagcag
ggcttaaggctcagtttggagttggtgtgaagtgagggatcagggctcagtcagagatgg
gtctcagctaggattgaggcttagtcaatactgggaatcagacttggggcccagcctagg
EXON 15  254 bp
gggctcagtcagagttggggactcagcctgggatcagggatcagtcagtgttagatttct
gcctagggcaggattcagtgggatcagggctcagtcagggtgggggactcatcctggagc
tggggctcagtccatgggcatgagcccaccaggccctgctgagctagccctggtccgcag
ATCCAGTACAATGGGCTCACACTGGATGTGGATGGCCGTACCACCAAGAAGCTCATCACG
CACCTCAAGCCCCACACCTTCTACAACTTTGTGCTGACCAATCGCGGCAGCAGCCTGGGC
GGCCTCCAGCAGACGGTCACCGCCTGGACTGCCTTCAACCTGCTCAACGGCAAGCCCAGC
GTCGCCCCCAAGCCTGATGCTGACGGCTTCATCATGGTGTATCTTCCTGACGGCCAGAGC
CCCGTGCCTGTCCA
gtatgctcacccccatgctccgggttccttgtcacccccatcagcctactatatggctgg
ggcaagccacgtgccctctctgtgcctcaatttccttgcctatgaaacacagaccctatc
agccctagttcatggggtcatccaagattcaatgcttctcatgggtcattgtcactaaat
EXON 16  94 bp
ccaaggcctggaggcctgagtcagcaactgtggcgtttgtggatggggcataggggaata
ggctcattgtatgaacagaagggaagactcagagaaacggcttcccccgtttgcccccat
gaagcatcccttggtcatccctatcgacagcccctctgactctttcccatctccctacag
GAGCTATTTCATTGTGATGGTGCCACTGCGCAAGTCTCGTGGAGGCCAATTCCTGACCCC
GCTGGGTAGCCCAGAGGACATGGATCTGGAAGAG
gtgagggcctggggcccaacccgcagggcccagatgcattccagttttcacgtgctctgt
tgctcccagctgagctctgagccacccatgactctgttcccgcagctcatccaggacatc
tcacggctacagaggcgcagcctgcggcactcgcgtcagctggaggtgccccggccctat
EXON 17  216 bp
gtgccactgcgcaagtctcgtggaggccaattcctgaccccgctgggtagcccagaggac
atggatctggaagaggtgagggcctggggcccaacccgcagggcccagatgcattccagt
tttcacgtgctctgttgctcccagctgagctctgagccacccatgactctgttcccgcag
CTCATCCAGGACATCTCACGGCTACAGAGGCGCAGCCTGCGGCACTCGCGTCAGCTGGAG
GTGCCCCGGCCCTATATTGCAGCTCGCTTCTCTGTGCTGCCACCCACGTTCCATCCCGGC
GACCAGAAGCAGTATGGCGGCTTCGATAACCGGGGCCTGGAGCCCGGCCACCGCTATGTC
CTCTTCGTGCTTGCCGTGCTTCAGAAGAGCGAGCCT
gtaagtcctgaatggtgtccgcccacatccagacacacctctgaatgaggcagaccccat
tccccagggccctgacctctgtggtcagtcacaggcagctccctgtggtcagagctgggc
agaggggaagacttgggagcggagggatcctgaaacgaaggtttcttagaggaagagacc
EXON 18  158 bp
agggaatggggagagcaaagattggcagggaccaggtcacataggccaccagggtcaagg
ttctaggaatataggaggatctagagcgggggagaaacgtaggttcatgtttgagaaaga
cccatctggccactacaaggagggtggacactgatggagacccccctcctttccctgcag
ACCTTTGCAGCCAGTCCCTTCTCAGACCCCTTCCAGCTGGATAACCCGGACCCCCAGCCC
ATCGTGGATGGCGAGGAGGGGCTTATCTGGGTGATCGGGCCTGTGCTGGCCGTGGTCTTC
ATAATCTGCATTGTCATTGCTATCCTGCTCTACAAGAA
gtaagccccatgtcctccccgacttgacttgacagcagggagggcttcctggaaaaggag
ggaggagttgtctcagagaatcatcactaaaggtctctgttgtacacatggggaaaccga
agttcagagaggttaagccacttgatcaaggtcacacagcatgggaatggcagagctagg
EXON 19  12 bp
tgtggtgtcgataggcagggggacaaacaggaaatatgagcaccattttccagaggagac
caaagctcacagaggttaaggaaggcactgagagtcacagaacaagcccttgatggccgg
cacaccctcacctttcttctttttttcccccttctcacctgtgtctgctttcgggaacag
CAAACCCGACAG
gtaagaaccagccctcccccgtggaggcttcaggcaagaggaagaggacagggaatgggc
tgatagtgtgcccacaggagaggggatgcccggctgcccccacagcttgtacacgtagct
gtacttggtcctggaaaccctagtcatacgggtccatggtccttttcttaccatgcattc
EXON 20  113 bp
caggagaggggatgcccggctgcccccacagcttgtacacgtagctgtacttggtcctgg
aaaccctagtcatacgggtccatggtccttttcttaccatgcattcctggggcctgaatt
gtgttcacacatgaacatgtgccactactaactggactgttccgcttgcttctcctaaag
TAAACGCAAGGACTCAGAACCCCGCACCAAATGCCTCCTGAACAATGCCGACCTCGCCCC
TCACCACCCCAAGGACCCTGTGGAAATGAGACGCATTAACTTCCAGACTCCAG
gtatgtacttatccctggtaccagggatgccaccaacaggggagatagctggggagaagc
agtagctgccaccctgggggcccctcattggccccctctgaactatgcttggtgcagcca
cattctggattcccaaatacctccaaccctacatggatctgggcttggaactcataggtt
EXON 21  98 bp
gggtcccagccccttcatgagccaccctgagtcttcccctcctgccaagccccaccccgg
ccatgcccttctaaccacagctcacccatcgcagactcacacgtagatcacccccctccc
ccgagtccccggctggccccccaagtgaccaaccccggcggggtctgctccaccctgtag
GCATGCTTAGCCACCCGCCAATTCCCATCGCAGACATGGCGGAGCACACGGAGCGGCTCA
AGGCCAACGACAGCCTCAAGCTCTCCCAGGAGTATGAG
gtgagcccacccccgcctcccaccctcatcacctcggcctcacaggcacctaccctgaca
cccgcgctctccccttcctctgtagtccatcgaccctggacagcagttcacatgggaaca
ttccaacctggaagtgaacaagccgaagaaccgctatgccaacgtcatcgcctatgacca
EXON 22  124 bp
tgcttagccacccgccaattcccatcgcagacatggcggagcacacggagcggctcaagg
ccaacgacagcctcaagctctcccaggagtatgaggtgagcccacccccgcctcccaccc
tcatcacctcggcctcacaggcacctaccctgacacccgcgctctccccttcctctgtag
TCCATCGACCCTGGACAGCAGTTCACATGGGAACATTCCAACCTGGAAGTGAACAAGCCG
AAGAACCGCTATGCCAACGTCATCGCCTATGACCACTCCCGTGTCATCCTCCAGCCCATT
GAAG
gtagttcggagatcccgggtcttaacctgcccttccccactgcatggaaagtgctagatc
ccatgtctccccttgggccactgaggcctgattctggtcatagacctggtccagctccaa
ctggaggccactgggcatctttagatatgtatttaactgatggctgctctctctaacatg
EXON 23  176 bp
gcgatctggccccaaatggtgatggcgctgagggggagaaactgtgaagtacacgtccca
tggtcaccttggggacaatctgggagcggtcagagtgaacttccaggaagtggttggcca
cacagagccaaactagcaagacagcccccacagatccctggcctctcgccctggctgcag
GCATCATGGGCAGTGATTACATCAATGCCAACTACGTGGACGGCTACCGGTGTCAGAACG
CGTACATTGCCACGCAGGGGCCGCTGCCTGAGACCTTTGGGGACTTCTGGCGTATGGTGT
GGGAGCAGCGGTCGGCGACCATCGTCATGATGACGCGGCTGGAGGAGAAGTCACGG
gtgagccttggaccccacggccctcaagcccctgccagtcagcctgtccctgctgacacc
tgttctcttgcccgatacagatcaagtgtgatcagtattggcccaacagaggcacggaga
cctacggcttcatccaggtcacgttgctagataccatcgagctggccacattctgcgtca
EXON 24  120 bp
ggggccgctgcctgagacctttggggacttctggcgtatggtgtgggagcagcggtcggc
gaccatcgtcatgatgacgcggctggaggagaagtcacgggtgagccttggaccccacgg
ccctcaagcccctgccagtcagcctgtccctgctgacacctgttctcttgcccgatacag
ATCAAGTGTGATCAGTATTGGCCCAACAGAGGCACGGAGACCTACGGCTTCATCCAGGTC
ACGTTGCTAGATACCATCGAGCTGGCCACATTCTGCGTCAGGACATTCTCTCTGCACAAG

gtggggcccaggctggggctgggggctgagggtggaggaatgtgttggaagggaggcaga
gggccccagcttctacccagggagctccccatgggacagagagaaagcggagcgtgtcta
cccaggctgactacattctcatggaacccacttccgtggagggggaaactgaggctcaga
EXON 25  155 bp
aggtttctccatgttggtcaggctggtctcgaactcctgacctcaggtgatccgcccacc
tcggcctcccaaagtgctgggataacaggcatgagccaccacacccggccacttgggcat
cttcagcacatgggtggcaggttgagccggagtgacaggtgacatccttgtggtccccag
AATGGCTCCAGTGAGAAACGCGAGGTCCGCCAGTTCCAGTTTACGGCGTGGCCGGACCAT
GGCGTGCCCGAATACCCAACGCCCTTCCTGGCTTTCCTGCGGAGAGTCAAGACCTGCAAC
CCGCCAGATGCCGGCCCCATCGTGGTTCACTGCAG
gtacgtccaccccactctgccccatccgcttccccccggtccccgcagcccagcagcccc
tgaacgccacgtggctgtccctgcagtgccggtgtgggccgcacaggctgctttatcgtc
atcgacgccatgcttgagcggatcaagccagagaagacagtcgatgtctatggccacgtg
EXON 26  286 bp
gcgtgcccgaatacccaacgcccttcctggctttcctgcggagagtcaagacctgcaacc
cgccagatgccggccccatcgtggttcactgcaggtacgtccaccccactctgccccatc
cgcttccccccggtccccgcagcccagcagcccctgaacgccacgtggctgtccctgcag
TGCCGGTGTGGGCCGCACAGGCTGCTTTATCGTCATCGACGCCATGCTTGAGCGGATCAA
GCCAGAGAAGACAGTCGATGTCTATGGCCACGTGACGCTCATGAGGTCCCAGCGCAACTA
CATGGTGCAGACGGAGGACCAGTACAGCTTCATCCACGAGGCCCTGCTGGAGGCCGTGGG
CTGTGGCAACACAGAAGTGCCCGCACGCAGCCTCTATGCCTACATCCAGAAGCTGGCCCA
GGTGGAGCCTGGCGAACACGTCACTGGCATGGAACTCGAGTTCAAG
gtgccagcggggtggaggctgctgtgggcggggtggggaggaggcccaaagagccgaaaa
tcaggcccgcctcgagcaatggggactagaaggtggtggcagggtgcccctacctaccta
tccaccattggtgctccagctgaaagcatagccttcctcatcctgatggtggcctctggc
EXON 27  179 bp
ggctgctgtgggcggggtggggaggaggcccaaagagccgaaaatcaggcccgcctcgag
caatggggactagaaggtggtggcagggtgcccctacctacctatccaccattggtgctc
cagctgaaagcatagccttcctcatcctgatggtggcctctggcttcctcctccccacag
CGGCTGGCTAACTCCAAGGCCCACACGTCACGCTTCATCAGTGCCAATCTGCCTTGTAAC
AAGTTCAAGAACCGCCTGGTGAACATCATGCCCTATGAGAGCACACGGGTCTGTCTGCAA
CCCATCCGGGGTGTGGAGGGCTCTGACTACATCAACGCCAGCTTCATTGATGGCTACAG
gtaggtgccatgcctttcccacctcagggccccagaaggagcccatctctactctcaaga
ggcctccagtcttgtgggagacagagctggggagatactggtagccctgagctgtttaaa
tacacatctttagatgtatatttaactgatggctgctgtccgtgaatctttgggtgtgtg
EXON 28  127 bp
ccacatgcaaaatgggatcaccaggaggggaagtggtgcacccagcagccattcctggca
ggcagtggggtggtaggtgtagctgtcactggcttggtcctgaccctcccgggcagcatc
aggtgagtaccacgccgggtctccctgccggccctgggctcatacccccaacgcctgcag
GCAGCAGAAGGCCTACATCGCGACACAGGGGCCGCTGGCGGAGACCACGGAAGACTTCTG
GCGCATGCTGTGGGAGAACAATTCGACGATCGTGGTGATGCTGACCAAGCTGCGGGAGAT
GGGCCGG
gtgagctaggggccacagcagggaagggcgagggccagactgtggctcagacagcgctga
ccacggccgccatctcctccacaggagaagtgtcaccagtactggccggccgagcgctct
gcccgctaccagtactttgtggtagatccgatggcagaatacaacatgcctcagtatatc
EXON 29  126 bp
ccgctggcggagaccacggaagacttctggcgcatgctgtgggagaacaattcgacgatc
gtggtgatgctgaccaagctgcgggagatgggccgggtgagctaggggccacagcaggga
agggcgagggccagactgtggctcagacagcgctgaccacggccgccatctcctccacag
GAGAAGTGTCACCAGTACTGGCCGGCCGAGCGCTCTGCCCGCTACCAGTACTTTGTGGTA
GATCCGATGGCAGAATACAACATGCCTCAGTATATCCTGCGAGAGTTCAAGGTCACAGAT
GCCCGG
gtgagtgaagagacagactggcgggaggggctggagccttagtgatctggaaagggctgc
cctggttggtgatggatacaaaggccaagggttaggcataagcattgggaatcaggagaa
gtgtcagctgaccagttggccacttgcttctactgccacataggtggaagagagggtctt
EXON 30  155 bp
aggtggaggttgcagtgagccgagatcacgccattgcactccaacctgggcgacaagagt
gaaactccatctcaaaaacaaacaaacaaacaaaaaatgggggtgaagatagggaggatg
gagaaaaacccccatggccgctgctgacctgataacaagattgggctctctgcactctag
GATGGCCAGTCCCGGACTGTCCGGCAGTTCCAGTTCACAGACTGGCCGGAACAGGGTGTG
CCAAAGTCGGGGGAGGGCTTCATCGACTTCATTGGCCAAGTGCATAAGACTAAGGAGCAG
TTTGGCCAGGACGGCCCCATCTCTGTCCACTGCAG
gtgagctccctcgagtgtcccagcttttggccctgctggggaaactgaggcctggtgggg
acagccccaagcttaggctgtcccatctgggctgttagagtcctcggggaatcgggtggt
cagatcagggctccccagcacctgcccctgaatggctgtgctcactttactgccaccagt
EXON 31  136 bp
ggtgagctccctcgagtgtcccagcttttggccctgctggggaaactgaggcctggtggg
gacagccccaagcttaggctgtcccatctgggctgttagagtcctcggggaatcgggtgg
tcagatcagggctccccagcacctgcccctgaatggctgtgctcactttactgccaccag
TGCCGGCGTGGGCAGGACGGGCGTCTTCATCACGCTTAGCATCGTGCTGGAGCGGATGCG
GTATGAAGGCGTGGTGGACATCTTTCAGACGGTGAAGATGCTACGAACCCAGCGGCCGGC
CATGGTGCAGACAGAG
gtaaagatgggacagggaggggaggcagcctggcctcacgccccgactgcccctaagctc
cagtttcctcctctgtgagatgggtacagccacctgggactctctgggtcactgtgggta
gacggtccacagacccctcccgcactggaaggggaccagtaacccttttaacacaacagt
EXON 32  473 bp
tgttaggcagagaggtgtggcatagctcacttcattgtgggagggccgtgggggccaaag
agaccttctgcaagagacacgcacaaggctgaggagcttggcctgctcctgagggcgata
gggagccctgggaggcgttagagcagcggaggtactaacaggtcacctctgctcccccag
GATGAGTACCAGTTCTGTTACCAGGCGGCACTGGAGTACCTCGGAAGCTTTGACCACTAT
GCAACCTAAAGCCATGGTTCCCCCCAGGCCCGACACCACTGGCCCCGGATGCCTCTGCCC
CTCCCGGGCGGACCTCCTGAGGCCTGGACCCCCAGTGGGCAGGGCAGGAGGTGGCAGCGG
CAGCAGCTGTGTTTCTGCACCATTTCCGAGGACGACGCAGCCCCTCGAGCCCCCCCACCG
GCCCCGGCCGCCCCAGCGACCTCCCTGGCACCGGCCGCCGCCTTCAAATACTTGGCACAT
TCCTCCTTTCCTTCCAATTCCAAAACCAGATTCCGGGGTGGGGGGTGGGGGGATGGTGAG
CAAATAGGAGTGCTCCCCAGAACCAGAGGAGGGTGGGGCACAGACCATAGACGGACCCCT
CGTCCTCCCCCAGCGGTGGTAGGGGGACCCGGGGGGCTCCTCCCCGCTCTGCA
gcctggggacactgggctgggaccagaatccagctttcttttaaaactctcagtgtaact
gtatcccgtgacatttcattttttttaaatagtgtatttttttttccattttttttttta
agagaaacaaacaaaagactcgccagtcaatgactttcaaagagaactaactttggctta