Gene PPP1R14A Variant 1
DNA : 5.30 KbNT_011109
mRNA : 718 bp NM_033256
CDS : 444 bp NP_150281
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  394 bp
gcaggcgctcccgcaccaacagccccccaccccgccaccgccagagggcgcagacaggcc
gggtcccgagtgtctgtcccaggcccccgccccacaggatcccggcccgggagcccccga
tgcagggacccgcccgggactctgggtccccgcccatacctcaacttcgcacgactgcgt
GCCTCAAGCCGACGCAGCGGCCTACTCTCGCACTGCAGACGGGGAAACTGAGGCCTGAGG
CGGCCGGGGTGGGGCAGACCTCCCGGCGAGCCCGAGCCCCCGCCCCCGGCTAGCCCCGCC
CTGGCCCGTAAGAAGCACCCGGGGCGCGAGGCGAAGGCGCACAGCGCGGGGCCAGGCTGG
GTCCAGCAGCGCGATGGCAGCTCAGCGGCTGGGCAAGCGCGTGCTGAGCAAGCTGCAGTC
TCCATCGCGGGCCCGCGGGCCAGGGGGCAGTCCCGGGGGGCTGCAGAAGCGGCACGCGCG
CGTCACCGTCAAGTATGACCGGCGGGAGCTGCAGCGGCGGCTGGACGTGGAGAAGTGGAT
CGACGGGCGCCTGGAGGAGCTGTACCGCGGCATG
gtgagcccggggagggctcgggggtggtcggggacagatagagcccgggcgcggagaccc
cacgcccttggggtctcggtgcacactcgctggtgcacggccagcctggtctgcacaaga
ggacgagcgccccagggccgggcactcattggcctggccatccgtgctctatggcattgt
EXON 2  81 bp
tcacccctcccccccaacacccagatgtcccgtcttggcagtgctgtcccggactgccac
attaatgctccagaacccgccagctgggccctggggccggtggggctcctgcagagccct
ggacaaaggcgagggagggagggaaggggatcctaagcacccctccctccctggccctag
GAGGCAGACATGCCCGATGAGATCAACATTGATGAATTGTTGGAGTTAGAGAGTGAAGAG
GAGAGAAGCCGGAAAATCCAG
gtaggtggggggacgtgtcccccagcctcccactttgcacctccctaaaaataatagcaa
tagttcacgtgtttactgagtgctcactagatgccgggcactggtgtgatggctttacat
gtattcactcacttaaccctcacaaaaccctccgaagcaggcgctagtgtgagctccatt
EXON 3  33 bp
ctgagtcgatccacatgccccttgggctctgttcctctcttgaagcttggtgggcagtcc
accctggagtctgacttccatttgtcttgctgctggggccttttgggaaagggaaggggc
tggaggggagtaggtgttagtcatttactgttttgttttgttcttggttgggggttttag
GGACTCCTGAAGTCATGTGGGAAACCTGTCGAG
gtgagttttctctccctcattctctccctgttctggccccaagtactctgatgggggagg
gggaagaagctggcagaagggtctctggggaacaccacccggccccaccacccccggccc
caacctgccctccgcagctctttctggtctccaggggtgtcttttgtcctcctacttgtc
EXON 4  210 bp
cccatctctgtctttctcccggctcacttttctctctatgtctatagcctccgcccctaa
ctccccccaccccacaatcagagaacaggaggaggcgcccaggtcagggactgggctgga
caggggcagagggtgcccccgcactgttcccatgttctcagctcccccaccctgtctcag
GACTTCATCCAGGAGCTGCTGGCAAAGCTTCAAGGCCTCCACAGGCAGCCCGGCCTCCGC
CAGCCAAGCCCCTCCCACGACGGCAGCCTCAGCCCCCTCCAGGACCGGGCCCGGACTGCT
CACCCCTGACCCTCTTGCACTCTCCCTGCCCCCCGGACGCCGCCCAGCTTGCTTGTGTAT
AAGTTGTATTTAATGGTTCTGTAACAATAA
cactgtgtggctgtttttcctccccccgggttaccatgggcttccccgagctccccccac
aacctccctctctcctcctgtggcctctgctcatgtccctgtcccagcactgcagctggg
cctgccagatggagaatcactcctcccgggccagaaagcatgagaacgggccctgctgag