Gene POLD1 Variant 1
DNA : 33.67 KbNT_011109
mRNA : 3443 bp NM_002691
CDS : 3324 bp NP_002682
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  52 bp
tcatggggaggcggagttaagggaatttttcagcaagggggcgaggccacttcggaagct
gagagagggggcggggcctgccctgcagtcgaacaagcggggcgtggccttgcccgcact
tgggcaggcgggggcgtggcccgtctctgagcgccgcggctctgggcttgcgcgcgcggg
AGTCAGGGGTCACGGCGGCGTAGGCTGTGGCGGGAAACGCTGTTTGAAGCGG
gtgagtagaggggaaaaagggagttcggggcagtgggcctggtagggaacggggcttgag
cagccaggcacatagatctgagagacggttgcgagggcaccctttggcccgggggcgcgc
aggagagggcaggggccaggggtttcctgggcgagggcgcggggacgagcaggaaaaggc
EXON 2  203 bp
aattgagcgtctggaatgtgctcccaccccactgcctgcagggtgcagagagctatgtta
gtacagccagtccagagtaggaaaaggctcgtggtcatggtgggtgcatgggatgccatg
gagacagggtaagaggtgtctccggtcagaacctccaccaagctccaacttgcccagcag
GATGGATGGCAAGCGGCGGCCAGGCCCAGGGCCCGGGGTGCCCCCAAAGCGGGCCCGTGG
GGGCCTCTGGGATGATGATGATGCACCTCGGCCATCCCAATTCGAGGAGGACCTGGCACT
GATGGAGGAGATGGAGGCAGAACACAGGCTGCAGGAGCAGGAGGAGGAGGAGCTGCAGTC
AGTCCTGGAGGGGGTTGCAGACG
gtaaggcttggagttggaggttcctgctgcccaacccattgcccctggtcttgcctttgg
tccaagagtcagctgcaaagctgacctgtgaccccactctggccaattttgaatcctaca
aaggactgcccttccaccccgtgcagcctgtgtggcctacagtgattctggccctgaccc
EXON 3  114 bp
cccgtgcagcctgtgtggcctacagtgattctggccctgacccttgaccctcattctctt
ccaagtttcctgcctgacccagaccaccacctctgcctggctcctttcagaaccacatgc
catcctggccggggaagaccatgactccatgtactccacttccttcccttcccccaccag
GGCAGGTCCCACCATCAGCCATAGATCCTCGCTGGCTTCGGCCCACACCACCAGCGCTGG
ACCCCCAGACAGAGCCCCTCATCTTCCAACAGTTGGAGATTGACCATTATGTGG
gtgagtttaggggttatgggtgagtgctggggccctgcgctcctggggcagaggccgggc
caggtcagcccctctggccctgtgctcctggggcagaggccgggccaggtcagcccctct
ggctctgcccctctggttgccatagagctgtagtgacagaacagaccagtgggtgccagg
EXON 4  147 bp
atggatcctgggggatgaggctggagatgggaaccaggggggaggctgaaatggacacag
ggaacggtacaggggcaggagtgccccaggctgcaggccccaaggtatttcgaggctgtg
gagacacaccttggaggaccctgagaggcatggccgctgtcttaccctgtgaccccacag
GCCCAGCGCAGCCTGTGCCTGGGGGGCCCCCACCATCCCGCGGCTCCGTGCCTGTGCTCC
GCGCCTTCGGGGTCACCGATGAGGGGTTCTCTGTCTGCTGCCACATCCACGGCTTCGCTC
CCTACTTCTACACCCCAGCGCCCCCTG
gtgagtggcccctacccagcccctccctgagccactggagccccctgcacctctgatcat
ccctcccacaccaggtttcgggcccgagcacatgggtgacctgcaacgggagctgaactt
ggccatcagccgggacagtcgcggggggagggagctgactgggccggccgtgctggctgt
EXON 5  126 bp
ggctccgtgcctgtgctccgcgccttcggggtcaccgatgaggggttctctgtctgctgc
cacatccacggcttcgctccctacttctacaccccagcgccccctggtgagtggccccta
cccagcccctccctgagccactggagccccctgcacctctgatcatccctcccacaccag
GTTTCGGGCCCGAGCACATGGGTGACCTGCAACGGGAGCTGAACTTGGCCATCAGCCGGG
ACAGTCGCGGGGGGAGGGAGCTGACTGGGCCGGCCGTGCTGGCTGTGGAACTGTGCTCCC
GAGAGA
gtgagtgctcccccaggatcagcgggttggagggtcccctcgggaggccattggctggtc
ccagcttcttccatccacaggcatgtttgggtaccacgggcacggcccctccccgttcct
gcgcatcaccgtggcgctgccgcgcctcgtggccccggcccgccgtctcctggaacaggg
EXON 6  169 bp
ctgcaacgggagctgaacttggccatcagccgggacagtcgcggggggagggagctgact
gggccggccgtgctggctgtggaactgtgctcccgagagagtgagtgctcccccaggatc
agcgggttggagggtcccctcgggaggccattggctggtcccagcttcttccatccacag
GCATGTTTGGGTACCACGGGCACGGCCCCTCCCCGTTCCTGCGCATCACCGTGGCGCTGC
CGCGCCTCGTGGCCCCGGCCCGCCGTCTCCTGGAACAGGGCATCCGTGTGGCAGGCCTGG
GCACGCCCAGCTTCGCGCCCTACGAGGCCAACGTCGACTTTGAGATCCG
gtacggcctctgcctcacttctccggcctctatccccaccctcgggcagcccctgtccac
tgacccccagccccctccaggttcatggtggacacggacatcgtcggctgcaactggctg
gagctcccagctgggaaatacgccctgaggctgaaggagaaggtgcagggcttcccaggg
EXON 7  82 bp
tggccccggcccgccgtctcctggaacagggcatccgtgtggcaggcctgggcacgccca
gcttcgcgccctacgaggccaacgtcgactttgagatccggtacggcctctgcctcactt
ctccggcctctatccccaccctcgggcagcccctgtccactgacccccagccccctccag
GTTCATGGTGGACACGGACATCGTCGGCTGCAACTGGCTGGAGCTCCCAGCTGGGAAATA
CGCCCTGAGGCTGAAGGAGAAG
gtgcagggcttcccagggcagggctgggtggggagctggtaccctgctgccaccgctgac
ccacccatgcccacaggctacgcagtgccagctggaggcggacgtgctgtggtctgacgt
ggtcagtcacccaccggaagggccatggcagcgcattgcgcccttgcgcgtgctcagctt
EXON 8  130 bp
actgacccccagccccctccaggttcatggtggacacggacatcgtcggctgcaactggc
tggagctcccagctgggaaatacgccctgaggctgaaggagaaggtgcagggcttcccag
ggcagggctgggtggggagctggtaccctgctgccaccgctgacccacccatgcccacag
GCTACGCAGTGCCAGCTGGAGGCGGACGTGCTGTGGTCTGACGTGGTCAGTCACCCACCG
GAAGGGCCATGGCAGCGCATTGCGCCCTTGCGCGTGCTCAGCTTCGATATCGAGTGCGCC
GGCCGCAAAG
gtctgtccccgggcccgggctcctgcccgcctcattgatgtgccaagtcgggggtcggaa
aggcaggtccggtggagggaatggcaagcatgaaggtgccggggcaggagcaccccagcc
catgtggccagatggagtgagcacagagggtgtggagatggcctggaggtgagagcagag
EXON 9  167 bp
atggagtgagcacagagggtgtggagatggcctggaggtgagagcagagcaggagccagg
gtgagccacgtagggccggcaggcagcggggacagccccggggagatggcaggtgcagcc
tccctgctgtgttgggagtgaggggcaggagtcaggcccctgcatcctcctgcctcgcag
GCATCTTCCCTGAGCCTGAGCGGGACCCTGTCATCCAGATCTGCTCGCTGGGCCTGCGCT
GGGGGGAGCCGGAGCCCTTCCTACGCCTGGCGCTCACCCTGCGGCCCTGTGCCCCCATCC
TGGGTGCCAAGGTGCAGAGCTACGAGAAGGAGGAGGACCTGCTGCAG
gtagctctcgctccacgccccacaccatttcccggggtccccgccagcctccgcgtcctg
agccatcagctcctgggtgctgcgacgcccatgtctgtgggtctgggtgggtgtctgtgg
gtctgggtgggcccctgtgcaattaggcttgagcacttcccctctgggttctgcaggatt
EXON 10  105 bp
tctgtgggtctgggtgggtgtctgtgggtctgggtgggcccctgtgcaattaggcttgag
cacttcccctctgggttctgcaggattttcaggggtggctggggttctagaacattctgg
aagtaggggaatccgaggcagggcaaccaccagggtgacccaatgtgctcccacccccag
GCCTGGTCCACCTTCATCCGTATCATGGACCCCGACGTGATCACCGGTTACAACATCCAG
AACTTCGACCTTCCGTACCTCATCTCTCGGGCCCAGACCCTCAAG
gtgagggctgggcaggtgggaggcttctctcagatgccccaggtgtggcctccgggccct
gggcctccttcccactccctctccacatggcttggtgcatcttgctctgtgtgcctcagc
cgattgcctgcaggggcagcctaggcctggtcctgccctgctccaagtcgaaaaagttac
EXON 11  141 bp
ggactccctccccagtctccagccacccacacccagccccagaccgtctttctgccccca
gggttgctctcgaccccctagggttgttataaggatgttgtggttggtctcaatctccgt
tcttcaggcttatgtgacggggacccgcagcctgctgcacaccctgcctctcctcctcag
GTACAAACATTCCCTTTCCTGGGCCGTGTGGCCGGCCTTTGCTCCAACATCCGGGACTCT
TCATTCCAGTCCAAGCAGACGGGCCGGCGGGACACCAAGGTTGTCAGCATGGTGGGCCGC
GTGCAGATGGACATGCTGCAG
gtatgggcgggaggtggggtgtgtccctgtccttggaaggccactgcccaggcccgcagc
ccaccagcccacccacccacctaggtgctgctgcgggagtacaagctccgctcctacacg
ctcaatgccgtgagcttccacttcctgggcgagcagaaggaggacgtgcagcacagcatc
EXON 12  111 bp
aacatccgggactcttcattccagtccaagcagacgggccggcgggacaccaaggttgtc
agcatggtgggccgcgtgcagatggacatgctgcaggtatgggcgggaggtggggtgtgt
ccctgtccttggaaggccactgcccaggcccgcagcccaccagcccacccacccacctag
GTGCTGCTGCGGGAGTACAAGCTCCGCTCCTACACGCTCAATGCCGTGAGCTTCCACTTC
CTGGGCGAGCAGAAGGAGGACGTGCAGCACAGCATCATCACCGACCTGCAG
gtgcctgctgcctccctgacctctcaccccaacctctgacctccacctcacccttccccg
gcctctgacctcaacttcacgcccccacgtctgacctcactctttgacctgctgttatga
cctgtgaccttacctgacgcccactttttcctgacctctgaccccagatttctctccact
EXON 13  192 bp
tccctggcccccaaccctacctccatccccacccagaccctgacgacttggagggccctc
ctgcccgcctcacctcccaggccctccccaggctacctcaccctgacccccacttccttc
tcctgctccacctcccacccccaacccctggtccctgaccccatccgtgcccatccccag
AATGGGAACGACCAGACCCGCCGCCGCCTGGCTGTGTACTGCCTGAAGGATGCCTACCTG
CCACTGCGGCTGCTGGAGCGGCTCATGGTGCTGGTGAACGCCGTGGAGATGGCGAGGGTC
ACTGGCGTGCCCCTCAGCTACCTGCTCAGTCGTGGCCAGCAGGTCAAGGTCGTATCCCAG
CTGTTGCGGCAG
gtcagtagccgagacttgtcctcgccaccccccaccaggcacgtctgtggccccctccag
gcaatggcatcctggatgcactttttctccccactcccaatccgcacggccccacctata
cccactccatttcccaccttctcccctcccaggccatgcacgaggggctgctgatgcccg
EXON 14  89 bp
caaggtcgtatcccagctgttgcggcaggtcagtagccgagacttgtcctcgccaccccc
caccaggcacgtctgtggccccctccaggcaatggcatcctggatgcactttttctcccc
actcccaatccgcacggccccacctatacccactccatttcccaccttctcccctcccag
GCCATGCACGAGGGGCTGCTGATGCCCGTGGTGAAGTCAGAGGGCGGCGAGGACTACACG
GGAGCCACTGTCATCGAGCCCCTCAAAGG
gtgaggccccaggctgggtgcagtttttacctgtaatctctgggaggctgaggtgggagg
atcacttgagctcaggagtttgagaccagccagggcaacatagcgaggcccctgctccac
aaaatttttttatttttatttatttttatttttatttttttgagacagagtctcgctctg
EXON 15  117 bp
actcctgagttcaagcgatcctcctgcctcagcctcccaatgtgctgggattgcaggagc
gagcactgctcccagccaatgaatgattttttttttttaaagggtgaggccacaagacag
ggcgggggcggcatgggaactcctagccctgactcccggccgcggctgctcccctcccag
GTACTACGACGTCCCCATCGCCACCCTGGACTTCTCCTCGCTGTACCCGTCCATCATGAT
GGCCCACAACCTGTGTTACACCACGCTCCTTCGGCCCGGGACTGCACAGAAACTGGG
gtatagtgcccaattcagcatgtgtcccccgaggcccatctgggccttcccttggggggc
tcagtctggtggggggcataggcacaggcccagagatagtagggagtggaggggtgcttg
aggggcctgcgtgtgctcatggccaaggccaggaccgtagggcagaggtgggctggagca
EXON 16  114 bp
tgggccttcccttggggggctcagtctggtggggggcataggcacaggcccagagatagt
agggagtggaggggtgcttgaggggcctgcgtgtgctcatggccaaggccaggaccgtag
ggcagaggtgggctggagcaggagggtggccggcagtcaccccaacatcttccaacccag
CCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGAGTTTGTGAAGACCTCAGT
GCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGTGCCCGGAAGAG
gtgagccctggagatcgcctgcttggagctcagacctgttggggcctctgggcaatccct
gtccctcactgggacaccccagggctgcccagccaccctgccctcagctgtgcgtgaatt
agcacaaggcatcccctcctggcagcttccttttgcccccttggccagaagcttctgtgc
EXON 17  148 bp
tcagctgtgcgtgaattagcacaaggcatcccctcctggcagcttccttttgcccccttg
gccagaagcttctgtgcagtgcacagtacgcccaaccgtacatggcactcacttccagaa
aggagccctgaccaatgcccaggtgccgcctgagtgtgctttccccgtgttccctcgcag
GGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCCGGCGCCAGGTCCTGGATGGACG
GCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGTATACGGCTTCACTGGCGCCCAGGTGGG
CAAGTTGCCGTGCCTGGAGATCTCACAG
gtgggcactcgggcccctggaaggcaactgggggcaggtgggccccctgtgtaggagacc
agggctccatgtgggggacctgtatccagaggactgggcaccccaactcactggccttct
agagagaggatgccaatgtggcttgagcaattggtccattccttcactcagcaaatgcct
EXON 18  96 bp
aggagccgccttatagtcccattttgcagatttgggaactgaggcccaggaggggcagag
tggcttgtacataagcctatgccactgggaaatggcagaggcgggacccctcccccgccg
gcccacgttcactgcacatggcccccagggcttcactccgcatgattctctccccgacag
AGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCTAAG
TACACAGTGGAGAATGGCTACAGCACCAGTGCCAAG
gtcgggggctgcccaccgctgccctgagatgggcccagggcaggtggggggatggaagcc
gggccggacccccatgtccccgtgcctcctggtcacaccctgcccactctcctgttgcat
ccttgggtcccgttggcattagccacctgccaccccccgacaccagtagttgacagaagg
EXON 19  138 bp
caggtggggggatggaagccgggccggacccccatgtccccgtgcctcctggtcacaccc
tgcccactctcctgttgcatccttgggtcccgttggcattagccacctgccaccccccga
caccagtagttgacagaagggaccctgcttctcacatacacacatccccaccgcccgcag
GTGGTGTATGGTGACACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAG
GCGATGGCCCTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACTTCCCGTCGCCCATC
CGGCTGGAGTTTGAGAAG
gtgcgtggctgggtcaggggctctgcatttaggtgccctcatcagggtactcagggtgtc
ccgttctttgggttcacaaaagccacagtgtgaagggatgttgctgcttagattctcctg
aggctggggccttggtttgggaagcctccaaggccttgggctttgttaccctggatggca
EXON 20  176 bp
gggcctcaggagccacttccagccatacagtgtctcggtccatcccaccaggctcagggc
acggctcccatgtcctcaaactgcgtctgggaccctgtctaccttcagtttctggggggc
gtctccagattggggcttggcctcctcaggctcagggtcttggccatggctccctcccag
GTCTACTTCCCATACCTGCTTATCAGCAAGAAGCGCTACGCGGGCCTGCTCTTCTCCTCC
CGGCCCGACGCCCACGACCGCATGGACTGCAAGGGCCTGGAGGCCGTGCGCAGGGACAAC
TGCCCCCTCGTGGCCAACCTGGTCACTGCCTCACTGCGCCGCCTGCTCATCGACCG
gtgtgtggggcctcctccctcagactcagggggctgggccccaaacccctcctccctcag
acccaggagtctaggccccagcccctcctccctcagacccacgggtccaggcccccagcc
ccctcctcctcagatcccggggtcagggcccccagccccttcctctcttagatacaagag
EXON 21  153 bp
gggcagctgtgggttcaggccctgcctctgccactctgcagcctatggtaggaagggccc
ctctctgccctgagcctcagccctaagagctcatcctggtctccagccctgagacccgtg
gaggcaccagcctggccctcagtgccttttggtgacgctgtgcggcccgctctcctacag
AGACCCTGAGGGCGCGGTGGCTCACGCACAGGACGTCATCTCGGACCTGCTGTGCAACCG
CATCGATATCTCCCAGCTGGTCATCACCAAGGAGCTGACCCGCGCGGCCTCCGACTATGC
CGGCAAGCAGGCCCACGTGGAGCTGGCCGAGAG
gtcctgcgcggggcgggtggcctggccagaaataaccccctccttcctgccagctgggcc
cacttcctacaccctcgcccccacccccgccacccacctgccctcacccacccgccaccc
catctccacgcaggatgaggaagcgggaccccgggagtgcgcccagcctgggcgaccgcg
EXON 22  103 bp
gcctccgactatgccggcaagcaggcccacgtggagctggccgagaggtcctgcgcgggg
cgggtggcctggccagaaataaccccctccttcctgccagctgggcccacttcctacacc
ctcgcccccacccccgccacccacctgccctcacccacccgccaccccatctccacgcag
GATGAGGAAGCGGGACCCCGGGAGTGCGCCCAGCCTGGGCGACCGCGTCCCCTACGTGAT
CATCAGTGCCGCCAAGGGTGTGGCCGCCTACATGAAGTCGGAG
gtcaggcccacctggctgcctgctcccgcccagccccctcgctctcacttctgctttccg
agatgggcgggcctgcgggaagggtggggcctcccgtgccctgtggggccctgagaaccg
ccccccatggcagcctgggtgtggcctcggccccctctggaggtcccccctctattctga
EXON 23  133 bp
ccctacagactctgtggcccagagactccgtgacctccgaccccatcccagacccaggcc
ccccccatgtcacagcccgcaggcaggcctaggccctaagccccaggccccatgaccacc
ccgtgtccaccccggtgccctttccctggctgcccgggtgtgactgccatgtggccgcag
GACCCGCTGTTCGTGCTGGAGCACAGCCTGCCCATTGACACGCAGTACTACCTGGAGCAG
CAGCTGGCCAAGCCCCTCCTGCGCATCTTCGAGCCCATCCTGGGCGAGGGCCGTGCCGAG
GCTGTGCTACTGC
gtacgggggcaccaggggactgggggcaccctgggggggcagaggagatcaccggcccac
cacctgcctcctctcctgcagggggggaccacacgcgctgcaagacggtgctcacgggca
aggtgggcggcctcctggccttcgccaaacgccgcaactgctgcattggctgccgcacag
EXON 24  114 bp
ttgacacgcagtactacctggagcagcagctggccaagcccctcctgcgcatcttcgagc
ccatcctgggcgagggccgtgccgaggctgtgctactgcgtacgggggcaccaggggact
gggggcaccctgggggggcagaggagatcaccggcccaccacctgcctcctctcctgcag
GGGGGGACCACACGCGCTGCAAGACGGTGCTCACGGGCAAGGTGGGCGGCCTCCTGGCCT
TCGCCAAACGCCGCAACTGCTGCATTGGCTGCCGCACAGTGCTCAGCCACCAGG
gtgagcggccctggccactgggcccccactggccctcaacctgctctgccgtcaccccag
atcctagacacccaccccatcggctggcactgccacccagtgggcccagggcccctgggt
gggtggcccctgtctccaccccccacagagggtcctcggcccccaccccgggagttcccc
EXON 25  53 bp
cccacagagggtcctcggcccccaccccgggagttccccaggggagttttcccagcacac
ttgctccgttgttctccagcctctggggactttcagaagctgggattggcagtgggcagg
gatggggtggcccagttcctggctgggccccagcacttgggctgacccgcctccccacag
GAGCCGTGTGTGAGTTCTGCCAGCCCCGGGAGTCTGAGCTGTATCAGAAGGAG
gtgagagggccgggaggtgaggaggggccaggtggggaggcgggggcgccctgctcagcc
gctgccgtccccaggtatcccatctgaatgccctggaggagcgcttctcgcgcctctgga
cgcagtgccagcgctgccagggcagcctgcacgaggacgtcatctgcaccaggtgtgtgc
EXON 26  98 bp
tggcccagttcctggctgggccccagcacttgggctgacccgcctccccacaggagccgt
gtgtgagttctgccagccccgggagtctgagctgtatcagaaggaggtgagagggccggg
aggtgaggaggggccaggtggggaggcgggggcgccctgctcagccgctgccgtccccag
GTATCCCATCTGAATGCCCTGGAGGAGCGCTTCTCGCGCCTCTGGACGCAGTGCCAGCGC
TGCCAGGGCAGCCTGCACGAGGACGTCATCTGCACCAG
gtgtgtgccatgtcccgaccctgggctgccccgccccttcccagctcccaggcctgtggg
ttgtggacccaacctctgactccaaggcctctcctgagcatcctccccgcccatcccctt
ccagctgtgagctgtcctgagcctcagtgtccttgtctgaaaaatgggcccatcccagcc
EXON 27  172 bp
gttatcggctccccccccccaccccccccgtgcctgctgagcaaacagcccgctgcggga
gggggcgggtgggctgggcagcaggcggggaccaaagtcctgggaacagcccccacccct
ctcccaggctgggcactgggccttggctggtcctgaccctgcccctgcccccacccgcag
CCGGGACTGCCCCATCTTCTACATGCGCAAGAAGGTGCGGAAGGACCTGGAAGACCAGGA
GCAGCTCCTGCGGCGCTTCGGACCCCCTGGACCTGAGGCCTGGTGACCTTGCAAGCATCC
CATGGGGCGGGGGCGGGACCAGGGAGAATTAATAAAGTTCTGGACTTTTGCT
atatggtgctttgtggtctctgggggacactgtctggtttcataagccctggccttggct
gggaccctcctgaggcccgcaccgcccctcatcctcagcaaaagcccccggactcccacc
tgtgctgcctggttcatgtgggccaagcctgcctcagtttcctctctggccctgaaggaa