Gene PEPD Variant 1
DNA : 134.82 KbNT_011109
mRNA : 1889 bp NM_000285
CDS : 1482 bp NP_000276
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  33 bp
cgggagccccgccccatcggggctccgcccttccccaggtaccgccccttcccgtcccgt
ggaatttggctctggaggaggtgggtcaaggactccatgccccgccccctgccccgccct
taccccgccccatgcattggcacccggaggggctcagctgacgccgcacttcacgtgacg
CCGGTGCCGGGCGAACATGGCGGCGGCCACCGG
gtgagtgctgcgcctccctcgctctttcccgctggcgtggagaggggcatgggtgtcccg
gccggaccgcgggtgagagcgtcagccggggtcgctgaatgccgcgggtaggcgcctctt
cccgttggcccggagtcccagcgccggtcggcgagctgcacgctccgagtcagggtcagc
EXON 2  184 bp
cagggggatcagtgaggggctgtttctgggtcataagtaggtggagcttgggcagcttgc
cccgtgctgatgggggtcccacggcaggctcgggcctccggtcaccccgacctcaggtgt
gggcatgcttggagatgctaacagaggcctgtgtggcggtgtgtgctcttgcctctgcag
ACCCTCGTTTTGGCTGGGGAATGAAACCCTGAAGGTGCCGCTGGCGCTCTTTGCCTTGAA
CCGGCAGCGCCTGTGTGAGCGGCTGCGGAAGAACCCTGCTGTGCAGGCCGGCTCCATCGT
GGTCCTGCAGGGCGGGGAGGAGACTCAGCGCTACTGCACCGACACCGGGGTCCTCTTCCG
CCAG
gtgagcctccccgcttggccacaagtgagcaggtgtgtgatggtgctgctgtcctgagca
ggagttggaggccccagcttggccagtgctgccccttgtggccctccctgagcctctgtt
tcctcgcctgggaagtggtccaggggctccttgaagatgtagaacttgaagatgtggggc
EXON 3  128 bp
caaactacgggaggatgagctggggagtcgagtgctgaggggaagggatgtctggggctg
gggtcagttacaggaggctgtcggtctgagctggctctctagggtgctgtgatgcagcca
ccggtccctccttgcacctcatgttccactggctaacaatagttcttgttcccgccacag
GAGTCCTTCTTTCACTGGGCGTTCGGTGTCACTGAGCCAGGCTGCTATGGTGTCATCGAT
GTTGACACTGGGAAGTCGACCCTGTTTGTGCCCAGGCTTCCTGCCAGCCATGCCACCTGG
ATGGGAAA
gtaaggagcagcctggccagggcaccatggctaccaaccatgggctgggggtgggtaggg
gaggtgggatgagagagctgggttgggcctggggacggggaggagggaagagctgcagga
ggaagggcatgcggtcagggctgtcacagcctgcctctcgccagagccctgcacccttgg
EXON 4  64 bp
gcctttgccctccaagtgtgtgttgggccgacctgttcggtgccgggtgctgggtgctgg
gtgctgaccgtgatagggatgggactggggctccatggcctgggcttggcaggcaggaag
gtggccatgctgagccattaccaagccctgaccctgatattccttgtgcttttctttgag
GATCCATTCCAAGGAGCACTTCAAGGAGAAGTATGCCGTGGACGACGTCCAGTACGTAGA
TGAG
gtgggtagccggctcctcctctgagcagcccagggcttccagcatgccttccactcctgg
agttcctctccttccactgccacaaccttgctggatgtcagggacactaccacctggcca
ccagtccctgcgccgcaggtgctcccatttggaaggagtaggcagcaacccatgcctcag
EXON 5  48 bp
aagtccttcaaccaggggaagctgggtttcttcacctgcagggtgagggcagcgcccacg
tcgcctgttctaatgatctgcttgataaatgtgcactgtcattatgaaggaatggtggca
tgtcatcttcattaggcttagtggtgcctctaaagtgggtttttctttccgaccttctag
ATTGCCAGCGTCCTGACGTCACAGAAGCCCTCTGTCCTCCTCACTTTG
gtaagtggctggtgtccaggggtggggcagtgcttggctctggggagggtttttatgggg
gccacctctcctgcagaggtcgggcccataggggaggattaaaaaacggagaggggttgg
gtccaggggctcacgcctgttatccaagtgccttgagaggcaaggtgggaggatcgcttg
EXON 6  62 bp
aggtctgtccttgtgttggggccgggcctggagctacctggctgggtggctcatctgttg
ggggaaggcaggaggggatcctgttcttacctgtcctgagcctagctggaggcctcaggg
gtgcaggctgtgggggcgccatgcggccccgtgtgtcatgtctgtgttctctctccccag
CGTGGCGTCAACACGGACAGCGGCAGTGTCTGCAGGGAGGCCTCCTTTGACGGCATCAGC
AA
gtgagtcctgggcccccagggactctttccccaccatcccccactcccaccttcactagc
aggtctttcccggtctacaaataagacatgaactatgcaaacttctttttaaggagtttg
ggcattttgaggaaatgtttagaagcataatttgccaaaaatcaccttgatttttcttga
EXON 7  43 bp
ccaggctgccaggtctgctgaaggaagggatcaacaggccttttgtgggtcaggaagtca
tgaaattaaagtgtgggaccctctttaatgcatcacgtgtgcatgtcttgaatgaggtag
ttcttgctgggacatgacagaccgttggattaatgggcttgatttcttttcgccctacag
GTTCGAAGTCAACAATACCATTCTTCACCCAGAGATCGTTGAG
tggtgagtacggcctgtggtcaccttgcctgtttgttgtgctcggctcatggggatggaa
tgccctgttgttcctgcccacaccgtctcagagagcccctcagaaagcagattcccagaa
ccttctcccatagccttttctgttttgcttgttctttgttgttggttgactggccgtact
EXON 8  78 bp
ttttcttctagactgttccatggagcttgtcactcctgggccttggtggccccactctgg
ccttgcacaacacgccttctgggctgtgcagggtgtggtaggccctgagctctccctgga
ggggtccagccagtgcctcctgaaagtcactgatttgctgctttgttcttctgtctctga
AGCCGAGTGTTTAAGACGGATATGGAGCTGGAGGTTCTGCGCTATACCAATAAAATCTCC
AGCGAGGCCCACCGTGAG
gtaagtcaggcaccggctctggttgagtggggaaagcagtgttgctgtgtggcgagagaa
ctgcgtgaggatgaagggtttccaggtgggctctaatccctgagggccaagtgagaggta
ggaagttttacacagtgattgttctcttttctgttccctggtgggcacagggcagggaca
EXON 9  47 bp
ggattttggagcttttaaaaagttctaatttgtcacatgtctgtaccactgcatgcacat
atcattctttttttcctttttaaagaagaggtgcttttgaagaagtgctgtatgttattt
atcacgctgtgttactgatctgcttaatacaaatgtctttgcttaatatccgtcctccag
GTAATGAAGGCTGTAAAAGTGGGAATGAAAGAATATGAGTTGGAAAG
gtaagccaccatgtttctccgggtaaaattaaaaggtaaaaaacagtaatttatgttccc
tgagtgagtaacagatgagacgccgcagtggcacacacaccgtgagcggagattatgaac
agggcttcaggatcacaagcaaagattatttttcttctgactgcgcccgcctccctggct
EXON 10  69 bp
cagcctatgactgacccccaggctgtaagcctcacagactcacactgagagtttggacca
ttgtggggccacggcaggggagaccatgggccgagggccttcccttggggttcatggggc
tcgtggagtggggtgtgcctgctctagtgccccaaccctgacgcgtctctccccctgcag
CCTCTTCGAGCACTACTGCTACTCCCGGGGCGGCATGCGCCACAGCTCCTACACCTGCAT
CTGCGGCAG
gtaagcggggcaccctggctcccctgggggtgaccagtgggaggaggtagggcagttagt
gagtggggggctccaccatcccccagctcagccacacttgctcactcacacgcccacacc
agcgcccggcccaagcttggaagtcgctcctccctcccaagactcccggagctgaggtgg
EXON 11  78 bp
gacagggccaccatgtcccccggccttacctctggctgtggacctggtccagccacgcct
gggcctgtgctggaggtggggacagtgctgctcatgggcaggggatcgagcatccacccc
ctccttcagagcctgctgcagaagaatgggctttgatcaccctcccccggctctttgcag
TGGTGAGAACTCAGCCGTGCTACACTACGGACACGCCGGAGCTCCCAACGACCGAACGAT
CCAGAATGGGGATATGTG
gtaagtagggccagcggccctggctctgtgtgtgaacagccaggccaaggttggactcaa
cttcaagatggcccagaagcctctgggtccctgtcctgagagggctgaccacagcaagtc
cctgggcttcttggcccagacttctctgccaaggctatcggcctgcgtggtgccttctcc
EXON 12  149 bp
ctgcccacgcacccgtgggagacaccaggtggcagttccccacaccggtctcattgtgag
ggggagttgcatccaggacccgggccagctgccctcgagtccagggcaggtggggagcgg
taagggtaagggggcggtggcaccccagtacccacttgccctgccttcctctctccgcag
CCTGTTCGACATGGGCGGTGAGTATTACTGCTTCGCTTCCGACATCACCTGCTCCTTTCC
CGCCAACGGCAAGTTCACTGCAGACCAGAAGGCCGTCTATGAGGCAGTGCTGCGGAGCTC
CCGTGCCGTCATGGGTGCCATGAAGCCAG
gtgagcagcgggtcggtggggggaggcgcatctgacgtggcgttgggggcgctgctatgt
ggcaggtgcctgcagggaacgggtctgcattgtgtgacttgaatctgccacactccagat
gcttagtccctgagattccagtggcgtcaggtctccagggtcactcctaggaaacaaggc
EXON 13  185 bp
acggggggccaccctagtccttgtccccctgggcccccgatgtagtacccttgccccctc
accccccacctcaggccctcccaccacagccagtgtgagggcttcacatctcccagcccc
tggccctgcggtgttggctgctgggctctgtggctcacggcagctccctctggcccacag
GTGTCTGGTGGCCTGACATGCACCGCCTGGCTGACCGCATCCACCTGGAGGAGCTGGCCC
ACATGGGCATCCTGAGCGGCAGCGTGGACGCCATGGTCCAGGCTCACCTGGGGGCCGTGT
TTATGCCTCACGGGCTTGGCCACTTCCTGGGCATTGACGTGCACGACGTGGGAGGCTACC
CAGAG
gtcagtgtggacatggcaggcggagtggcctgcccatcagctgccgctgagcctgacccc
cagggcagggtgggactctaggaggcagcaggcgtgtattgggatggcagggatgggccc
catggctccctgtggtatacggaggccatgaggaggggggaatcgggaccctggccaaga
EXON 14  192 bp
gtggaaggtcttatcagggtgcccatggcccagcacagcaggggcgagtctaggctgagg
accccaatggtcaagagagcccacgagactggcaccggccctcacatgcccatctctcct
gatgaggccacggtgagccctggagctgctcatcaggcccctcacctctgttccccacag
GGCGTGGAGCGCATCGACGAGCCCGGCCTGCGGAGCCTGCGCACTGCACGGCACCTGCAG
CCAGGCATGGTGCTCACCGTGGAGCCGGGCATCTACTTCATCGACCACCTCCTGGATGAG
GCCCTGGCGGACCCGGCCCGCGCCTCCTTCCTTAACCGCGAGGTCCTGCAGCGCTTTCGC
GGTTTTGGCGGG
gtgagtgcccacgggccccattcttgctcccagaacatctgccacctccactgcagctgc
agactccttagtcccaagacaggggccctagtgacatcttcccttgaggtgggcttagcc
tgccccttcgtgtggtctgtcacaggatggagcctcacccctcagtaggaacagacagag
EXON 15  529 bp
agacagggtgagcaggtgacatgggcagatggctccatgaaggagcccggaggccacccg
tctcccagggagtgtcagctgctcccatcccatggtggggtgggcctggaatgggcccgg
ccctctagcctggcacatgaggctgctctatgataatgtgtgtctgtcggcttgacccag
GTCCGCATCGAGGAGGACGTCGTGGTGACTGACAGCGGCATAGAGCTGCTGACCTGCGTG
CCCCGCACTGTGGAAGAGATTGAAGCATGCATGGCAGGCTGTGACAAGGCCTTTACCCCC
TTCTCTGGCCCCAAGTAGAGCCAGCCAGAAATCCCAGCGCACCTGGGGGCCTGGCCTTGC
AACCTCTTTTCGTGATGGGCAGCCTGCTGGTCAGCACTCCAGTAGCGAGAGACGGCACCC
AGAATCAGATCCCAGCTTCGGCATTTGATCAGACCAAACAGTGCTGTTTCCCGGGGAGGA
AACACTTTTTTAATTACCCTTTTGCAGGCTCCCACCTTTAATCTGTTTTATACCTTGCTT
ATTAAATGAGCGACTTAAAATGATTGAAAATAATGCTGTTCTTTAGTAGCAACTAAAATG
TGTCTTGCTGTCATTTATATTCCTTTTCCCAGGAAAGAAGCATTTCTGATACTTTCTGTC
AAAAATCAATATGCAGAATGGCATTTGCAATAAAAGGTTTCCTAAAATG
gtcctttgtgcgtggcttcccctttattcctttgcagatgagcatttgggaccccgtgca
ccctgaaaagatggctcacctggtgtcagtatcaagtcagttccaggaagatggtgctgg
cagcacaggccctctaacggctgcttctgcctcagactggcctggcgggacaagggcaga