Gene PAFAH1B3 Variant 1
DNA : 5.54 KbNT_011109
mRNA : 1003 bp NM_002573
CDS : 696 bp NP_002564
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  340 bp
cccatttgctagacagagggctagattttccccgcccactctcgactcttcaggtagttc
gcccctccccgtgaccggtgggtggtttctccctcctccccgcctcgggagctggatggt
ctcgcctctccctccccccaccccgtgccgggtgcgcggcctgggagtcagcggcccgag
CGGGAAGCGCCGGGCGAGCCCACTGTGCGGCCGTCGTGGGGGAAGCGAAGGTTCCTGATT
CCACCTACCTCCTAAGTGAAGGCTTCCGTCCCTGGAGAGGAGGCGGCGCCCTGTATCGGC
CTTCGTCCTCCGCGGGTGTGCTAGCGTTGGGACGGTCCTTTGTTGCCGCGAGGGGTAGGA
GTGGGCGTGGCGGAGCCAGCTCCGTTCGGAACACTCCCGGGCCGACCCGACTCGCTCATC
CTGCAGGAGCTGCGGCGCCAAGATGAGTGGAGAGGAGAACCCAGCCAGCAAGCCCACGCC
GGTGCAGGACGTACAGGGCGACGGGCGCTGGATGTCCCTG
gtgagcgttcccacctgggatattgaggagtccgggggcgcggggggtggctcaggagaa
cggctggttcgtgccactctcactacctgattgggaaactgagggcagttgaggaggcgc
tgcctaagggagcagggcggggcgggccctggagcgtgcatgccattgactccctctcgc
EXON 2  90 bp
acctgggatattgaggagtccgggggcgcggggggtggctcaggagaacggctggttcgt
gccactctcactacctgattgggaaactgagggcagttgaggaggcgctgcctaagggag
cagggcggggcgggccctggagcgtgcatgccattgactccctctcgcgcgctcccgcag
CACCATCGGTTCGTGGCTGACAGCAAAGATAAGGAACCCGAAGTCGTCTTCATCGGGGAC
TCCTTGGTCCAGCTCATGCACCAGTGCGAG
gtgagggcagtccctctccccctgccccatccagccctgtgtccatgctgacacatctgg
accagaacccaggccaggtgaggtattatgagagtacccagattggcctcaggcagcccg
aggctctgagaatcttggtgtaaggtgcaacattctattgagaaagaaatgtatgccttg
EXON 3  117 bp
ctataaagtgaggttcagccatgctggagtttgctccaggtaaaattttaagactgcttc
catgaagtaaggttcttccataatggcatttggttaacacctggacagagggggatggtc
catgcggacagtgcccttgtgcccctaccacttcttgcccacaccacttcttgcccacag
ATCTGGCGCGAGCTCTTCTCTCCTCTGCATGCACTTAACTTTGGCATTGGTGGTGACGGC
ACACAGCATGTACTGTGGCGGCTGGAGAATGGGGAGCTGGAACACATCCGGCCCAAG
gtgagcggggcttgggtggggctctaaaacatcttttggctgccccctcaccgctgcttc
atgtctctttttccacagattgtggtggtctgggtgggcaccaacaaccacggacacaca
gcagagcaggtgactggtggcatcaaggccattgtgcaactggtgaatgagcgacagccc
EXON 4  123 bp
ttctctcctctgcatgcacttaactttggcattggtggtgacggcacacagcatgtactg
tggcggctggagaatggggagctggaacacatccggcccaaggtgagcggggcttgggtg
gggctctaaaacatcttttggctgccccctcaccgctgcttcatgtctctttttccacag
ATTGTGGTGGTCTGGGTGGGCACCAACAACCACGGACACACAGCAGAGCAGGTGACTGGT
GGCATCAAGGCCATTGTGCAACTGGTGAATGAGCGACAGCCCCAGGCCCGGGTTGTGGTG
CTG
gtgagaggctgggagagtgggaaaggaagaatggcagtggtctgggaccccctcagatat
agccacagttggcacagttctaggcagcttgacatagagcagtggcttttaggcagaatc
tcacgttggagcttgctatacccttcagagtggctgtggttgagaatatgctccgagacc
EXON 5  333 bp
tcttgctaaatgagggctaggatgtgatatttaggaactaccctcccaccctccccactt
gcccatccctagtgttttctgcagctggaaacttcatggtggtgggtggaggacaggttg
gcacagagaacaagatactcaaatgcttgtttccttactacgcctcgtgttcctgctcag
GGCCTGCTTCCGCGAGGCCAACATCCCAACCCACTTCGGGAGAAGAACCGACAGGTGAAC
GAGCTGGTACGGGCGGCACTGGCTGGCCACCCTCGGGCCCACTTCCTAGATGCCGACCCT
GGCTTTGTGCACTCAGATGGCACCATCAGCCATCATGACATGTATGATTACCTGCATCTG
AGCCGCCTGGGCTACACACCTGTTTGCCGGGCTCTGCACTCCCTGCTTCTGCGTCTGCTG
GCCCAAGACCAGGGCCAAGGTGCTCCCCTGCTGGAGCCCGCACCCTAAGCATCCTGCTGC
CTTCCCACAACATTAAACTCTCCTTCCTCAGTG
tgctgtttcctgctttatggtcgaacctgtctgggtatctgggtaccaccattagtcctt
atcctgatctgtgaccctgcagttctgcaaggtgttttttgtgtgagacagggtctctct
ccgtcacccaggctagagtacagtggtgagaccacagcccactgcaacttcaacctccca