Gene NFIC Variant 1
DNA : 96.35 KbNT_011255
mRNA : 1507 bp NM_005597
CDS : 1287 bp NP_005588
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  51 bp
acagagagcgaggcgggcggcgcgagagagggagagcaggagggaggaggagggagaccg
agggaggaggcggcgaggagagcgcgccggccgcggggcgggggggggggttgggggggg
cgggggggtggtttggaaaaatgactcagtaagttcagcgcgcccgctccggccggccct
GCGCCTCCCGCCGCGCCCGGGATGTATTCGTCCCCGCTCTGCCTCACCCAG
gtacggtcctcgcccggccccccgccggcgcccccgcgccccccgcatcccagccccgga
gttttgaagcaggaggaggcgggacgaaaaaggcgcgcgtccctcccgccatccctgccc
gggatgccccccgcgccgagggctggggtccggtggggggatgggtcaggctggggtacc
EXON 2  532 bp
ccttttgcgtgcctccggcggcgtgcacgggtccgcagcgaccccctgcccacctctgcc
cagcccctcccactctgcgggtctgttcagggcccctccgacctcagccttcggggccgg
gcagtgggtccgccctctgcgtccctggcgctcctgacctctcgcctctccggcctgcag
GATGAGTTCCACCCGTTCATCGAGGCCCTGCTGCCTCACGTCCGCGCCTTCGCCTACACC
TGGTTCAACCTGCAGGCGCGGAAGCGCAAGTACTTCAAGAAGCACGAGAAGCGGATGTCG
AAGGACGAGGAGCGTGCGGTCAAGGACGAGCTGCTGGGCGAGAAGCCCGAGGTCAAGCAG
AAGTGGGCGTCGCGGCTGCTGGCCAAGCTGCGCAAGGACATCCGGCCCGAGTGCCGCGAG
GACTTCGTGCTGAGCATCACCGGCAAGAAGGCGCCGGGCTGCGTGCTCTCCAACCCCGAC
CAGAAGGGCAAGATGCGGCGCATCGACTGTCTCCGGCAGGCGGACAAGGTGTGGCGGCTG
GACCTGGTCATGGTCATCCTGTTCAAGGGCATCCCGCTGGAGAGCACCGACGGCGAGCGC
CTGGTCAAGGCTGCGCAGTGCGGTCACCCGGTCCTGTGCGTGCAGCCGCACCACATTGGC
GTGGCCGTCAAGGAGCTGGACCTCTACCTGGCCTACTTCGTGCGTGAGCGAG
gtgaggtgtggtggcctgagcggagcggccagcggggagggtgtctgatggtggtgacac
ggggccaggagggcctgagggaggaggccagtgcgtgtgggtatgatgtggtggtctgag
aggggaagtgggccttggagagtgcccaatgggggcgacacggggcacggagcatctgag
EXON 3  72 bp
gggcagcagccaagggaagggcccaaagagagaccccagggcctgggtgtgttttggggc
cactgtttgtctccatagcactggcccagcccaggactggggccaccagcatcgacactt
catctgctcctggggtggggtctctgtgatgccaccagtgtttcttccctctctttgcag
ATGCAGAGCAAAGCGGCAGTCCCCGGACAGGGATGGGCTCTGACCAGGAGGACAGCAAGC
CCATCACGCTGG
gtgagtctgggggcagcgtggcggtgaagggcggagggcgcagccctgtcctcgtctttt
atttgggaatcatttgcttggcaccactcgttttacagatgagcagactgaggctcggag
aggttaaggggcctgtccaggggctaccagggagctgggttggaacccacgactctgagc
EXON 4  81 bp
cactggacaaggaccccccacggggccttccccatcagactggagctgtcattcccccac
agcacaggatggacagggggaacgtccaggctcgggccagcccccaggagtccaggcagc
cctggagtgtggggaagggaaacaggcccagctcagcctactgaccccgctgtcttcctg
TTCCAGACACGACCGACTTCCAGGAGAGCTTTGTCACCTCCGGCGTGTTCAGCGTCACTG
AGCTCATCCAAGTGTCCCGGA
gtgagtgttcccgtcagccctgagctgggtcttggagaggggagggggccgcagggagga
aggagcccacccccctcaccctactccttgtcctttccagacaaccccctgtgtcactaa
gccaaggttcctagaaagggaggtggccaggcccttcccagagcccaaggtcagggctcc
EXON 5  124 bp
ccatggccttggtcctctgatccatagaataaaactggtttcagccaccctaggaaccgg
gccaatatgggaagggggtccccctttggactgcacccagtggctttccctacctctcta
aagcaaaccgcagcactgggcactgcttcctgcctcactctcctctgtcaccctctgcag
CACCCGTGGTGACTGGAACAGGACCCAACTTCTCCCTGGGGGAGCTGCAGGGGCACCTGG
CATACGACCTGAACCCAGCCAGCACTGGCCTCAGAAGAACGCTGCCCAGCACCTCCTCCA
GTGG
gtaagtacccaggtccccacctctgggcatttcatgaccccattcatcaacccatcccct
ctggcccgagctgactcattcctctccctggaatacctcttttcacgattcacctggcct
gagaaactcctactcatctcatccttcaaaacccagccagccccacgtgcctcttcccct
EXON 6  125 bp
gacaggttggaacaggcgttcgtagggaacgggctgaacgcccgcggctcccgcgatgtc
tcgcgatactacctccctcgcccccgctcacttaaggaccggaagtagcaaagcccgccg
tcgcgccccccgccccgcgtctccctggtaaccagcctctccccttccctcgcccataag
GAGCAAGCGGCACAAATCGGGCTCGATGGAGGAAGACGTGGACACGAGCCCTGGCGGCGA
TTACTACACTTCGCCCAGCTCGCCCACGAGTAGCAGCCGCAACTGGACGGAGGACATGGA
AGGAG
gtagggctggtggcgggggcggagccggccttccggtctgagtcaccgtggcgggaacta
cgtcttccggcagccactgcgcgggcgccgcggggcaggaagccggcctggagccgcggg
gcctcctgggaattgtagtcgtcccgagctgcgcttggctggaagtacggtccgggttcg
EXON 7  126 bp
ctctgagccttcgtttactcctctgtgtaatgggctcacagcctctccccctcaggattc
tggggtaagaggaggcggggtgatgaggcttcctatcccttcggaggctggctttgggga
aggtccagggctcatggggtgtgaccagcctgtgactctctcgtcccatcccctccacag
GCATCTCGTCCCCGGTGAAGAAGACAGAGATGGACAAGTCACCATTCAACAGCCCGTCCC
CCCAGGACTCTCCCCGCCTCTCCAGCTTCACCCAGCACCACCGGCCCGTCATCGCCGTGC
ACAGCG
gtaagcgccacgggcccctggcggggaggggcggcgggccctcctatcaggcctctcaca
gccggggaagtcccactggatgtctgaccatgagtcctattgctgtagccttctaggtgg
gcaaaaaaccatagaggtgccgtagtggagagcgcccagggccttgttccagcccggctg
EXON 8  185 bp
gtgggagtcggggaatttgggtgtcaatgtggtcagtgctgctgggtttttttggtggtt
attgttactaaacgcactgagatgccggcaggaatgacacccacagacacacagtcacac
ggtcacagagcagaccggctggagcccccaagtaacccccgcttcccactgtctccgcag
GGATCGCCCGGAGCCCACACCCGTCCTCCGCTCTGCATTTCCCTACGACGTCCATCCTAC
CCCAGACGGCCTCCACCTACTTCCCCCACACGGCCATCCGCTACCCACCTCATCTCAACC
CCCAGGACCCGCTCAAAGATCTTGTCTCGCTGGCCTGCGACCCAGCCAGCCAGCAACCTG
GACCG
gtgagttgggcggggcgcattcgggcctctcctggcggctccaggtgacctcccgggggc
cacgtgctcacacgaaggcacaacctctgcttaaaagggtcttgaggacttggctctgaa
gtcccctcctctgtcgtgctgggaggcagctggattgggtcagaattgagatgctttcgg
EXON 9  211 bp
acttgccatgggtcacccagcaggttgttagagcctgggatggggaaactgaggtcacag
ggttgcaggaggtggggggtgagcgtgggaagaggtaaaccatgtctgcagcagagtctg
acccctcgacttctctccctttttctctctccctctttctgtcgccactgggccactcag
TCCTGGTATCTGGGATAGCAAAGGTCTTCTTCCCTCGCCCCTTCTCCATCGTCCCAGGAA
TCCCAGGGGGCAGCACAGCCGGCCCCCGGCCCACGTTTTCGGTGGAAAATTAGAGTGAAC
AAGAACACCCCTGCCGACTCCCAGCCCGGCCAAAAAGACAAAACACATAGACGCACACAC
TCAGGAGGAAAAGAAAAAACAAAGGCAGAAG
aagaagaagaagaaataaaaacccacccaagcaagaagacaaaaggtaaagacgcaacgt
ttccaactctcgggacgccaaggccgcaggactggagggccaggccccgccacccccacg
ggagacccgggacagggcgtcttcctaagttattcatctcctctccgcctgctgctcggg