Gene NDUFA11 Variant 1
DNA : 8.97 KbNT_011255
mRNA : 426 bp NM_175614
CDS : 426 bp NP_783313
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  97 bp
gcgcgtgcgcgcgatccatgtccatgtccgcgcctatcaataaagttgctcacttgttgc
cggcccgctagcccgaaaggttgcgcgcgcagcccgagaagtctcgcgatagccagccgc
ggctgcccttgcgcttcccgagctggcggggtccgtggtgcgggatcgagattgcgggct
ATGGCGCCGAAGGTTTTTCGTCAGTACTGGGATATCCCCGATGGCACCGATTGCCACCGC
AAAGCCTACAGCACCACCAGTATTGCCAGCGTCGCTG
gtgagcgccggccgggccccgagggtggagggccgaggccgcagggaggtcgtggggtta
ctgggggctgtttggatcgaacgggtctgggagtctcgcgggtacgcacgtggttgtcat
cggggtgtcttgggcggtcgtagggggggatcttgtgtgaaatggatgttggtagggggt
EXON 2  93 bp
gttttggagcagcaaacccgagttcaaatccagctctgccactcagcagccggggacact
atgggcaaagaaggggggcatcgtgaggactgagggagggagaccacccagtggggtgcc
cggccaagcaagggcttagcagcagtggggtctgaacagcctccctcctctgtctcgcag
GCCTGACCGCCGCTGCCTACAGAGTCACACTCAATCCTCCGGGCACCTTCCTTGAAGGAG
TGGCTAAGGTTGGACAATACACGTTCACTGCAG
gtgagcacgctgggctgggcatggctgggccctctcctggcacagccccagctctcagag
cacatttgacggctgcctcttctctctgactccccagcccgtgtccacagtgctggccat
ccggagaaagtggggtgttcctttatcaggaatacatgtagggtggggaggcccaggaga
EXON 3  123 bp
gaatacatgtagggtggggaggcccaggagaacagctccaggactggggccaggaggctg
ccatgcacagcgagcagccgactcgtggcatctctctccatccagacactggcagtgagc
gcccaagaggctcctgctgtgcccgtctcgaggcccttgctcttcccgtctaccccgcag
CTGCTGTCGGGGCCGTGTTTGGCCTCACCACCTGCATCAGCGCCCATGTCCGCGAGAAGC
CCGACGACCCCCTGAACTACTTCCTCGGTGGCTGCGCCGGAGGCCTGACTCTGGGAGCAC
GCA
gtgagtggccccctccccacccccaccctcctcccagcctggcagaatgacccctgacct
ctgctcatcctccaccctctctgttccatcccggacaagaagtaaagcagccttcttgaa
caccagccatttcagtcatagcgacagctgctgctgctgcttaagcacctactgtggccc
EXON 4  113 bp
gtgcatcagtttccacatctccagagtctagggccctcttcctgagtgacttaatccctg
aagagagtgtcctgtcaggggtctcagtctggctcccagggtgggcaccggccagggcgt
ggagcgtcttggtccggccgagccccacccgggcctgacatcacctccccactcccacag
CGCACAACTACGGGATTGGCGCCGCCGCCTGCGTGTACTTTGGCATAGCGGCCTCCCTGG
TCAAGATGGGCCGGCTGGAGGGCTGGGAGGTGTTTGCAAAACCCAAGGTGTGA
gccctgtgcctgccgggacctccagcctgcagaatgcgtccagaaataaattctgtgtct
gtgtgtgtgtcagtgtccggagggcttgatgacggcgacacagcagccggtgagggcgga
tctgggagggagtgaggaagggagataagataaggccccctgcacacgcgcctgcctgcc