Gene NAPA Variant 1
DNA : 27.37 KbNT_011109
mRNA : 1261 bp NM_003827
CDS : 888 bp NP_003818
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  168 bp
gattggggggtcacgagtcacgggcggcgtgcggcggctggtgggggcgtgtccggcgga
gcgggcgcggcgttacgaggccgctggttggccagcgctagtcacgtggttcctggccgc
aagcgacgcgcgccggtgcgacgtcaacgcagccgggcgagttttaccgatctgtgttcc
GCGGCCCGGCCGCGGCTGAGTCTTCCCAGGGTCAGGGTCAGGCGCTTTGCTGAGTCCCTT
TGTGGCCGCCATGGACAATTCCGGGAAGGAAGCGGAGGCGATGGCGCTGTTGGCCGAGGC
GGAGCGCAAAGTGAAGAACTCGCAGTCCTTCTTCTCTGGCCTCTTTGG
gtgagaaccgggctgaggggtcggccgggacctaggctgagaggacgaaggagtcacgct
cggaggtggcgggttagggcacgcagagctcgggccgaggggacggagaggaacctgcaa
taaggtgacatggcctgaggcggcagaggggacgcaggctgagggccaagagcctgggcc
EXON 2  80 bp
tgagtgtgccattgtatgcaggggcgggggccacagactcaagaggcctgggggaagctg
gcttcacaggtgaagggtgaggggtaggggcacgtctgtgcccggcactggagcagaatg
cttgctttctcctggatagccgactagattgtctcctttttttctttcctttttccccag
AGGCTCATCCAAAATAGAGGAAGCATGCGAAATCTACGCCAGAGCAGCAAACATGTTCAA
AATGGCCAAAAACTGGAGTG
gtatgtcatctccgctagagctcctccaaggtgctctcctcctccctcagcttccactca
cacaggcctgcccgagaggttggccttgagggccctttctctttgtatgccctctccggc
atcggaaagccactggcctgctctcttgttttgtgcctgctgggttactttatactctgg
EXON 3  117 bp
ggagccaggagacctgagttctaggcctcggtctgggctcgctcaggtcaccctcgtcct
gtcttggggactctttccgcattctcgagagcccgacccacctcccagggcagtgtctct
gtggcttcataaagtgtggagccccactgaggccaggactgcccttctcttctgttccag
CTGCTGGAAACGCGTTCTGCCAGGCTGCACAGCTGCACCTGCAGCTCCAGAGCAAGCACG
ACGCAGCCACCTGCTTTGTGGACGCTGGCAACGCATTCAAGAAAGCCGACCCCCAAG
gtgagggcctctgcgggccacacgggctggctgtccggagcgccatcctagcaccctgca
ttgattcctcaggtttcctggcggctctggtttttccagtggccgacatgtgataggctg
gcaggggcgtgcctgaggcagagtgagcgttgactttagaactggctctcttccttccag
EXON 4  47 bp
ctcagggattccgtccccttcttcccagccccttgagagtgtgtggcagcgctggcagct
ctgagcgcctattgatctctctgctggcagccaggtgcgcctgcgtccgcctcctctcct
cagcttctgctgaaacgacttcactttctcatgtctcctcccacctccctttctctccag
AGGCCATTAACTGTTTGATGCGAGCAATCGAGATCTACACAGACATG
gtaagggctgcttgcttgtcctgacacccccgggtcccactgcattgccccagccttgcg
tcccctctttcagcacccccagcactgttcttattctgcggccaaaccacttggggaggg
ggaagtgggagctggggggattaggtcacctgagctggcctgggctggctgggtcttcac
EXON 5  78 bp
tggggccctcccttctcactcctgtgttcccccacctctcgatcttcttcacacctcagg
tcttcttcatacctcctcacaggcgtggctgaggggtgggaacttgaagggtcataggtc
agcaggcaggcacgcaggaggtcatgagtcgcaggcagccccttcctgtgtcccctccag
GGCCGATTCACGATTGCGGCCAAGCACCACATCTCCATTGCTGAGATCTATGAGACAGAG
TTGGTGGACATCGAGAAG
gtgagtggcagcagggccctgcatgggctggcagccaggaccagtgctgctctctcttct
tcccaccaggggagtcctctggtgtctgagtgccgagaagggggcatggggcgccggcag
agcttggagaatggggtctggctgtgtcccaggcaggcagggcggagggtgtggaagctt
EXON 6  56 bp
cccaccaggggagtcctctggtgtctgagtgccgagaagggggcatggggcgccggcaga
gcttggagaatggggtctggctgtgtcccaggcaggcagggcggagggtgtggaagcttc
acggaggcctcctctcccttccctgccctcccctggaacccatcccccgtgtctccccag
GCCATTGCCCACTACGAGCAGTCTGCAGACTACTACAAAGGCGAGGAGTCCAACAG
gtagcccccttcctgcctgccccagccccgcagggaccgccaccacttcccctcactact
cctccccacacagctcagccaacaagtgtctgctgaaggtggctggttacgctgcgctgc
tggagcagtatcagaaggccattgacatctacgaacaggtggggacaggtggggatggcg
EXON 7  85 bp
tcctctcccttccctgccctcccctggaacccatcccccgtgtctccccaggccattgcc
cactacgagcagtctgcagactactacaaaggcgaggagtccaacaggtagcccccttcc
tgcctgccccagccccgcagggaccgccaccacttcccctcactactcctccccacacag
CTCAGCCAACAAGTGTCTGCTGAAGGTGGCTGGTTACGCTGCGCTGCTGGAGCAGTATCA
GAAGGCCATTGACATCTACGAACAG
gtggggacaggtggggatggcggcttccaccctgccccctctcagggcctgtgcctcctc
ctaagccccggcaccttgttctggaaccacccctcccccggctcaccctctgcctctccc
ccgacatcccttgccatgtcatccccccaccctgtcttcagcctggctgaatgttctcca
EXON 8  105 bp
gcactggccgctgacctctccaagctggtccctggctccctgcccttggggtcctgggtt
aacagggcctcacctcgggacatgaaccagctcccagctggccccccagtgcctggcagt
ggctctggccctctggctgcttgccctgagctcaccagtgccacttctccatggctacag
GTGGGGACCAATGCCATGGACAGCCCCCTCCTCAAGTACAGCGCCAAAGACTACTTCTTC
AAGGCGGCCCTCTGCCACTTCTGCATCGACATGCTCAACGCCAAG
gtagcacaccccacgcccgcaggaccaccgcaccaggccaccatgtgcttatctccaggc
caggtcccgttgcccccgaagagggacgtgctcctccctcacgtctggcccctgccagcc
agcctttggatgagaagtgtggttctcacagctgtgtttctgtgctggcatcacctgccc
EXON 9  69 bp
ctgagctcagctacgggaaggtactgacagacacagagccaggtgacacctgaggctggg
ggaggggtgcaagagctgactcaatatcacccgacatccccaagtcccctcagctgctag
gccagtagctctgaggaccctcttgttactaactcatcttctcccttccctgctgcccag
CTGGCTGTCCAAAAGTATGAGGAGCTGTTCCCAGCTTTCTCTGATTCCCGGGAATGCAAG
TTGATGAAA
gtaagtgctgggtgctccggcctcccccttcccgaacctcagacgggggtggctggggct
ccaggtgggacaatcgccaagacttgtccagtagttctcagagggtgtctttgttttgtt
ttgttttgttttgttttgtttggccatttgagtctccattttccagatgaagaaagtaca
EXON 10  51 bp
agcaggatcgcaacacgcccgtacccatccccagtttaacccacacggattgaccctctg
agagtcctcaggaagccccagccccaggcctggcatacagatagcgtgtcctttcatcta
atccaggccagacctcaggtcagcataggcccctgacccctctctgccatttgcttgcag
AAATTGCTAGAGGCCCACGAGGAGCAGAATGTGGACAGCTACACCGAGTCG
gtgagtggccagcatggggggccaggccccttcacggggatgggtctcctaggaaagctg
cccttctcagacacgctctccatgacattcacccatttcatctggcccccagcccactgt
gaagttctttctccagtcaccccagaaaccttacaagtagcgccaagaggcgcagggagt
EXON 11  155 bp
gtcaagacagacaagagggagctcccatggctgagttggggcctcaagccctccctctac
tcctcctcagagaccaggggtgacagagacagatcttgaaaaccttgggacaagtgccct
tgggctgcagggttgggaacggggggagcatggccagcctatcacctggtgtgccctcag
GTGAAGGAATACGACTCCATCTCCCGGCTGGACCAGTGGCTCACCACCATGCTGCTGCGC
ATCAAGAAGACCATCCAGGGCGATGAGGAGGACCTGCGCTAAGCCCCACCCAGCCCCCCA
GTGCCCGTCTTCCTGTCCCATCTGCTCAGAGAGAG
gtggggccgagacttgctggagagcttccctcctttcccatctggggagtgccgcgggcc
acagtgggcaggtggcaccgggggtcagcatgcaggggcgccagaggcccaggctgctgg
ccggacagtcaccctctgttctcgctacatcccttgccccctgtccatttatttaagccc
EXON 12  250 bp
ccatttatttaagcccccataggtgcccttcacccccaaaaccagctgtacagaatcttt
gatacagacctatttgctaggggtgctgccggggatttggggtcagcatctggcccccta
tctcctgaccagctgagtcatgaggccggtttctctctctctcccacttttgtcccccag
CCAAGCTCTAAAGCACATGTAGCCGCTGAGACCTGCTGTTTCTGCTGGGGGCAGGCTCCT
CTTCCCCCAGCCCCGGGAGCCTCCCCCAGCTTCCTGCAGCCCCGACCTCTCAGGTTAGAC
CCTGGGCCCTGGAGCTTAGGGGATTCTCCCCACCCCAGCCCCACACCTGCTCCTTCCCTA
ATGCTTTGAGGTTTTCTTGGTTGGAAGCTGCAGCTGGCCCAAGAAAGAAAATAAAAAACA
ACACTTTTGC
atgagtctctcttcctcctcacctctgctacccactctgcccctgggccagtcaccagtc
cctctcacactcctggtcccccagactctgggcgagctcttgggaggtcaggcgcatgca
tccttgaaacacgtgtgggctgggtcagtttctaggtgggggagacccagggacggtggg