Gene KLK9 Variant 1
DNA : 7.12 KbNT_011109
mRNA : 1438 bp NM_012315
CDS : 753 bp NP_036447
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
ctccacacccccagcactcctcctccattcagtcaagctctggcccagcaagccgccagt
tcatcccaaaaggggggtccccctgcacttacctcctctcccaaggcccctgtcacagcc
ccagggcttccccctcccccaggtacatttcccaaccccgattaatcacaggggcggccc
CATGGAGGAGGAAGGAGATGGCATGGCTTACCATAAAGAAGCACTGGACGCCGGGTGCAC
GTTCCAGGATCCAGGTGCCCAGGGGTCATGAAGCTGGGACTCCTCTGTGCTCTGCTCTCT
CTGCTGGCAG
gtgaggctcccaggctggctgccccttcacggctgtactaaggtcaccttgctcttccct
cccatcccaggcttctgcctcctgccctctaggcttctcagcatcctctccctgccctcc
cagcctgctcttcgctgacccctttgtccctcatccccaccccagggcatggctgggcag
EXON 2  157 bp
tctctctgctggcaggtgaggctcccaggctggctgccccttcacggctgtactaaggtc
accttgctcttccctcccatcccaggcttctgcctcctgccctctaggcttctcagcatc
ctctccctgccctcccagcctgctcttcgctgacccctttgtccctcatccccaccccag
GGCATGGCTGGGCAGACACCCGTGCCATCGGGGCCGAGGAATGTCGCCCCAACTCCCAGC
CTTGGCAGGCCGGCCTCTTCCACCTTACTCGGCTCTTCTGTGGGGCGACCCTCATCAGTG
ACCGCTGGCTGCTCACAGCTGCCCACTGCCGCAAGCC
gtgagtgacccaggctggccatgctggggagggacagaggctgggggtcaggagagggtg
aggggtgctttaggccagaagtgcggagcctccacttctgataccacaagttcaactctt
agaagtaggaagggtagcctcccaaatcctaaaattctagagaccagcaatatctcattt
EXON 3  266 bp
ggaggtgtgtgcctcgcttaaaatcacagtaccctgggccagacatagatgatgagggtg
cagagagggtgtgtggcttgcagagggtcacacagcaccctgatggacaggaaaagaggg
ctggggctgaaaggacttttacctttcccccagcttgacctctgaggcctgtcccagcag
GTATCTGTGGGTCCGCCTTGGAGAGCACCACCTCTGGAAATGGGAGGGTCCGGAGCAGCT
GTTCCGGGTTACGGACTTCTTCCCCCACCCTGGCTTCAACAAGGACCTCAGCGCCAATGA
CCACAATGATGACATCATGCTGATCCGCCTGCCCAGGCAGGCACGTCTGAGTCCTGCTGT
GCAGCCCCTCAACCTCAGCCAGACCTGTGTCTCCCCAGGCATGCAGTGTCTCATCTCAGG
CTGGGGGGCCGTGTCCAGCCCCAAGG
gtatgacctggcccagaactctctctgaaacttgctccctcacccctctgtctctgcctt
ttcatctctgtcttctccttttctctctcctctctctctctgtcagtctatctatctgcc
aatcgatatatttaaccaaatataagatgctagcatttttaagatgtgccattatttcat
EXON 4  137 bp
catttgtttctcttgtgtgctatgactgtctgtctgtcactgtctcttgtctctatcttt
gagagtcctaaatgtggctccattggtcctttggaaaagctgcagggaggactcagggca
gtggggtgctgagtgtgttggagacagttgcagatccttgacagttctcttccctgacag
CGCTGTTTCCAGTCACACTGCAGTGTGCCAACATCAGCATCCTGGAGAACAAACTCTGTC
ACTGGGCATACCCTGGACACATCTCGGACAGCATGCTCTGTGCGGGCCTGTGGGAGGGGG
GCCGAGGTTCCTGCCAG
gtgagaccttactctggggaaaatgaggctgtcctgccaagttttctaggatttagggga
gcagaggggtcggcccccagccttcctgggtcaaaatgagaaggagactgggatacctgg
ttcctgggagaggacgggaccagggcctggactccttagtgtaaaagagaaaaggtctgg
EXON 5  748 bp
ggggaggtgggccctctgagcttttactcctgggtctgaggaagaagaggctggagatgg
aggactctcggatgttggaggaggaaggggctggggcctttctgggagggaggaagtggc
ccgtgtaattgtcatgaacagagtggcctaacagttcctctgcccttctctcgcgtacag
GGTGACTCTGGGGGCCCCCTGGTTTGCAATGGAACCTTGGCAGGCGTGGTGTCTGGGGGT
GCTGAGCCCTGCTCCAGACCCCGGCGCCCCGCAGTCTACACCAGCGTATGCCACTACCTT
GACTGGATCCAAGAAATCATGGAGAACTGAGCCCGCGCGCCACGGGGGCACCTTGGAAGA
CCAAGAGAGGCCGAAGGGCACGGGGTAGGGGGTTCTCGTAGGGTCCCAGCCTCAATGGTT
CCCGCCCTGGACCTCCAGCTGCCCTGACTCCCCTCTGGACACTAAGACTCCGCCCCTGAG
GCTCCGCCCCCTCACGAGGTCAAGCAAGACACAGTCGCGCCCCCTCGGAACGGAGCAGGG
ACACGCCCTTCAGAGCCCGTCTCTATGACGTCACCGACAGCCATCACCTCCTTCTTGGAA
CAGCACAGCCTGTGGCTCCGCCCCAAGGAACCACTTACACAAAATAGCTCCGCCCCTCGG
AACTTTGCCCAGTGGGACTTCCCCTCGGGACTCCACCCCTTGTGGCCCCGCCTCCTTCAC
CAGAGATCTCGCCCCTCGTGATGTCAGGGGCGCAGTAGCTCCGCCCACGTGGAGCTCGGG
CGGTGTAGAGCTCAGCCCCTTGTGGCCCCGTCCTGGGCGTGTGCTGGGTTTGAATCCTGG
CGGAGACCTGGGGGGAAATTGAGGGAGGGTCTGGATACCTTTAGAGCCAATGCAACGGAT
GATTTTTCAGTAAACGCGGGAAACCTCA
ccttctttctgcctgagctgtgagatgagtggagagcaaacgggtgggcggtgaagggca
gatgagggaaccggtaccgccttgcaactcccccttaaacccctagtaagttttgcctaa
agtctctgtccatcagccctattgcagcaagactcctgggttctgcttgggttggtcttg