Gene KLF1 Variant 1
DNA : 2.32 KbNT_011295
mRNA : 1152 bp NM_006563
CDS : 1089 bp NP_006554
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  150 bp
tgatatttgacttggctttggacacagggttagtctttaaccccagccccagacaggcca
acgtgaagtttgtgccccagaaacagtgcccccccgccgccttgccttgctttgccttat
cagaggctgcagccaatcagctaaggacagagaggagccctcgaaggggctatcacagcc
TCAGAGTTCACGAGGCAGCCGAGGAAGAGGAGGCTTGAGGCCCAGGGTGGGCACCAGCCA
GCCATGGCCACAGCCGAGACCGCCTTGCCCTCCATCAGCACACTGACCGCCCTGGGCCCC
TTCCCGGACACACAGGATGACTTCCTCAAG
gtggggcctagaaggtggggtctaggtgggctggctggaatccagggccacagtcacaga
tcttggggtccagacctgcatcttgacctgaaatcaagagacttaaccaggactgaggta
cgctcagtccaggagaggagatctcagcttagtctggcagggggtgaggagggtggtcta
EXON 2  826 bp
agctggggggggagcggggagaggggcggttagaggggcagtgttggggaagtgggacag
acagacaggcaaacaagacccctttccaaagcctctgcgtcagagtgtccagcccgcgat
gtccctgggcagggcaccccagtgtccaccgaacctcgagctgcctgctccctcccgcag
TGGTGGCGCTCCGAAGAGGCGCAGGACATGGGCCCGGGTCCTCCTGACCCCACGGAGCCG
CCCCTCCACGTGAAGTCTGAGGACCAGCCCGGGGAGGAAGAGGACGATGAGAGGGGCGCG
GACGCCACCTGGGACCTGGATCTCCTCCTCACCAACTTCTCGGGCCCGGAGCCCGGTGGC
GCGCCCCAGACCTGCGCTCTGGCGCCCAGCGAGGCCTCCGGGGCGCAATATCCGCCGCCG
CCCGAGACTCTGGGCGCATATGCTGGCGGCCCGGGGCTGGTGGCTGGGCTTTTGGGTTCG
GAGGATCACTCGGGTTGGGTGCGCCCTGCCCTGCGAGCCCGGGCTCCCGACGCCTTCGTG
GGCCCAGCCCTGGCTCCAGCCCCGGCCCCCGAGCCCAAGGCGCTGGCGCTGCAACCGGTG
TACCCGGGGCCCGGCGCCGGCTCCTCGGGTGGCTACTTCCCGCGGACCGGGCTTTCAGTG
CCTGCGGCGTCGGGCGCCCCCTACGGGCTACTGTCCGGGTACCCCGCGATGTACCCGGCG
CCTCAGTACCAAGGGCACTTCCAGCTCTTCCGCGGGCTCCAGGGACCCGCGCCCGGTCCC
GCCACGTCCCCCTCCTTCCTGAGTTGTTTGGGACCCGGGACGGTGGGCACTGGACTCGGG
GGGACTGCAGAGGATCCAGGTGTGATAGCCGAGACCGCGCCATCCAAGCGAGGCCGACGT
TCGTGGGCGCGCAAGAGGCAGGCAGCGCACACGTGCGCGCACCCGGGTTGCGGCAAGAGC
TACACCAAGAGCTCCCACCTGAAGGCGCATCTGCGCACGCACACAG
gtgagggggcggggccccggacatgagaaagggcgcggcgcccgctgtagttacagggga
agaagggttgcagagggcgggacttggacttggctggcctctgagagtgagtgcctcctt
aaattttgtgccctaggggcctcactttgttcatcctagtcccagcccaggctgagtaaa
EXON 3  176 bp
gcgggacttggacttggctggcctctgagagtgagtgcctccttaaattttgtgccctag
gggcctcactttgttcatcctagtcccagcccaggctgagtaaaggggtgtggccagatg
caggggacccggggacatgactgggcagacagtggcgcttatggcttccttgtcccctag
GGGAGAAGCCATACGCCTGCACGTGGGAAGGCTGCGGCTGGAGATTCGCGCGCTCGGACG
AGCTGACCCGCCACTACCGGAAACACACGGGGCAGCGCCCCTTCCGCTGCCAGCTCTGCC
CACGTGCTTTTTCGCGCTCTGACCACCTGGCCTTGCACATGAAGCGCCACCTTTGA
gccctgccctggcacttggactctcctagtgactggggatgggacaagaagcctgtttgg
tggtctcttcacacggacgcgcgtgacacaatgctgggtggttttcccacgaatggaccc
tctcctggactcgcgttcccaaagatccacccaaatatcaaacacggacccatagacagc