Gene IRF3 Variant 1
DNA : 6.10 KbNT_011109
mRNA : 1406 bp NM_001571
CDS : 1284 bp NP_001562
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  38 bp
ggaacagcccagcgggccgtcccatcggcttttgggtctgttacccaaagaatgataaag
ttggttttatttcaagaagtcgatcaaaaagaaagccccagcgctctagagctcagctga
cgggaaagggggtgcgcagcctcgagtttgagagctacccggagctccaagacaggggtg
GGTTCCAGCTGCCCGCACGCCCCGACCTTCCATCGTAG
gtaacgcggaagagcccgggagagcgttggtggcgtccgagagcgaggagcgggaaagag
gatgggtctgcacggagagtggaaaggcaggctgtgtactctggggaaagtggagcaagg
aaggagctacagtggccgacgctggaggtcggctgcagaaaaactagaaaaagtagggag
EXON 2  173 bp
ttagagagcctctcgggaggatgggaggatgggaagaggaggtttcctgtttgtaccccc
gaaaatatgggtgaaggacctgtgccgtggcccgtgagaaggaggtctgggtgcggaaac
tccaggccaggtgggtccgggggaggccggtcgcgcccaggaaatgccctatacgcgcag
GCCGGACCATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTGTCGCAGCTGGACC
TGGGGCAACTGGAGGGCGTGGCCTGGGTGAACAAGAGCCGCACGCGCTTCCGCATCCCTT
GGAAGCACGGCCTACGGCAGGATGCACAGCAGGAGGATTTCGGAATCTTCCAG
gtgcgtgcgacgacctgggacgctggaaacccggagctgcgcgctgggcggaaaggactc
ctagtgggcccggctgagaaggcggaggtggcgcgcgaggggcgggctcgtgccaacgct
ggtgggtggggctagaacgggaggggcggggctagccggatccgctgactgatggtgggg
EXON 3  172 bp
ttgaaaactagaggtgggggatggaggtaggtgggacggggggatttggggatggacctt
gcagagttagaacttgccagggaaagagggtggtgttaggactcgggagacagggttagg
gccccaggagcaggatctaagtcgtcctcccccaccatcctgacaccactgttgccccag
GCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACC
TGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGAC
CGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAG
gtctgccagcttggggttcgtgtgggaggctggggccccaagggttcctggcactcctac
tcccctcaccacttttctcaacaggagttggggacttttcccagccagacacctctccgg
acaccaatggtggaggcagtacttctgatacccaggtgagaatgtgcccaactttcatgc
EXON 4  71 bp
gctctgccctcaaccgcaaagaagggttgcgtttagcagaggaccggagcaaggaccctc
acgacccacataaaatctacgagtttgtgaactcaggtctgccagcttggggttcgtgtg
ggaggctggggccccaagggttcctggcactcctactcccctcaccacttttctcaacag
GAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTT
CTGATACCCAG
gtgagaatgtgcccaactttcatgcccctcagtctccgacctgtctccatgggccttgtc
ctctccctctagacgatccccccactcccctgcctccagcctgcccctcacctgagccag
tgctgaccctgtctgtccctgccccggtctcctcaggagaaaattccaagtcttcaccca
EXON 5  193 bp
cgttcattagtgtttgtttggctgttgatgccatggctggctctgtccccaggctggaag
ccccttgaaggcagagctcaagcctgacctccctgcgttgctgagaacagacctggtcca
tatgaagtctccagaaaaggatatggaaatgcctgattctctttttttgtttccctccag
GAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGA
CCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTG
GACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTG
GTGCCGGGGGAAG
gtgagtgtcagctgcaggctgggagggctgaggtctgggcggcagcccctgattctcaac
ccctctccccttcatgccgctgctgccgctgctcagagtgggagttcgaggtgacagcct
tctaccggggccgccaagtcttccagcagaccatctcctgcccggagggcctgcggctgg
EXON 6  381 bp
gccccagcttggacaatcccactcccttcccaaacctggggccctctgagaacccactga
agcggctgttggtgccgggggaaggtgagtgtcagctgcaggctgggagggctgaggtct
gggcggcagcccctgattctcaacccctctccccttcatgccgctgctgccgctgctcag
AGTGGGAGTTCGAGGTGACAGCCTTCTACCGGGGCCGCCAAGTCTTCCAGCAGACCATCT
CCTGCCCGGAGGGCCTGCGGCTGGTGGGGTCCGAAGTGGGAGACAGGACGCTGCCTGGAT
GGCCAGTCACACTGCCAGACCCTGGCATGTCCCTGACAGACAGGGGAGTGATGAGCTACG
TGAGGCATGTGCTGAGCTGCCTGGGTGGGGGACTGGCTCTCTGGCGGGCCGGGCAGTGGC
TCTGGGCCCAGCGGCTGGGGCACTGCCACACATACTGGGCAGTGAGCGAGGAGCTGCTCC
CCAACAGCGGGCATGGGCCTGATGGCGAGGTCCCCAAGGACAAGGAAGGAGGCGTGTTTG
ACCTGGGGCCCTTCATTGTAG
gtgagtgagacaggggcttcgacctggccagtacaaagcagcctgcacagtggttaacaa
ctcaggattggccgggcacggtggctcacgcctgtagtcccagcactttgggaggctgag
gtgggcagatgacaagttcaggagttcgagaccagcctggtcaacatagtgaaaccccat
EXON 7  116 bp
accctgatgggagggagggagggagggaaggaggggactttccccaaacaagcagtcccc
tggtcgaggcagcagagggccttaggtcaggggaggtggtgggggttatcattcaagttt
acggggaagggtgggtagagggtcctcttctcatccctgactaggctcctgggcccccag
ATCTGATTACCTTCACGGAAGGAAGCGGACGCTCACCACGCTATGCCCTCTGGTTCTGTG
TGGGGGAGTCATGGCCCCAGGACCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAG
gtgcctgcagacctgagtccctggggctgaaaggggtggccttacagagggaagaggttg
ctcccaggaactccaactcccagagggccctctaaaaaactgcaacttccaagatctctg
caataaccagtttttcatccccgggagctccttcccatggcctcacctgcagaacctgtt
EXON 8  262 bp
tgtgtgtgtgtgtgtgtgtgtgtgtgtgtaaaactacaactcccagcagccctaggccta
tggttcatcctaggttacagcaggggctgcagggagttgtagtcctccaagccctgactc
ctaccttggtggacagtggctgggtgttttccctgactcctgtccccacttcccctgcag
GTTGTGCCCACGTGCCTCAGGGCCTTGGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCC
CTGGAGAATACTGTGGACCTGCACATTTCCAACAGCCACCCACTCTCCCTCACCTCCGAC
CAGTACAAGGCCTACCTGCAGGACTTGGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAG
AGCTGAGCCCTCGCTCCTCATGGTGTGCCTCCAACCCCCCTGTTCCCCACCACCTCAACC
AATAAACTGGTTCCTGCTATGA
tcacttgtgcgtgtctggtgttgggtgccctctgacccaatatggttgttattcccgctc
agggtctcagtttacccatctgtgcagctatatacaactcaggtgctcaatgcatgaaga
ccaagcactgcagggggcagctgacacctcctcacttctgcccagggacctggtgggtga