Gene INSL3 Variant 1
DNA : 4.65 KbNT_011295
mRNA : 306 bp NM_005543
CDS : 306 bp NP_005534
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  190 bp
ctgggagaagtacatccaaggccctggccctgggagaaaggctctggcactaaccccacc
cttgacctttttcctgggcggtcctgaagaatgttctgtcccttctccaaggcccccagc
tgggacggcccaggcgcctataaagggggtccccgcttggccccggcgccacccaccacc
ATGGACCCCCGTCTGCCCGCCTGGGCGCTGGTGCTGCTGGGCCCTGCCCTGGTGTTCGCG
TTGGGCCCCGCGCCCACCCCAGAGATGCGTGAGAAGTTGTGCGGCCACCACTTCGTACGC
GCGCTAGTGCGCGTGTGCGGGGGCCCCCGCTGGTCCACCGAAGCCAGGAGGCCTGCGACC
GGAGGCGACC
gtgagtggggacgggcagggacagcgctctgggaagccgaggtggggcaggtgcacgtag
gcgcagatgcacacgtgcagggaggtgggcaggtttgcatgcatgtgcccagggctcacc
tgccggctgcgtgcacagatcgtgggtccgcactggagtgtgtgtgaacgcgcgtgtgaa
EXON 2  116 bp
agtgggatgtgtgtggattcgtgcacatgcagcatggggtagcatgtcctctgtcgtttc
cgttccagctgagtttcactctgtccccaggtgagttgctacagtggctggagagacgac
atctgctccatgggctggtggccgacagtaatctcacgctgggacctggcctgcagcccc
TGCCCCAGACCTCTCACCATCACCGCCACCACCGTGCAGCTGCCACCAACCCTGCACGCT
ACTGCTGCCTCAGTGGCTGTACCCAACAAGACCTGCTGACCCTCTGTCCCTACTGA
ttcctccttgggtgcagcctcagagtggcctgaggcccagagggtctggtctggtgagct
cctgaggccacacagcaccataaagtctcgcatctacaggcctttgattacctcctggga
tgggtgctcactatctaccccagaccaatgccacctgcagcctgtggagtcaactgcaga