Gene IL12RB1 Variant 2
DNA : 14.77 KbNT_011295
mRNA : 1085 bp NM_153701
CDS : 1021 bp NP_714912
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  128 bp
agacttgctccagagtctgtggccgccaccatcaccaccaccacggagctgacttcctgg
gtttctctttcactttgacttgccttagggatgggctgtgacactttactttttttcttt
tttcttttttttcagtcttttctccttgctcagcttcaatgtgttccggagtggggacgg
GGTGGCTGAACCTCGCAGGTGGCAGAGAGGCTCCCCTGGGGCTGTGGGGCTCTACGTGGA
TCCGATGGAGCCGCTGGTGACCTGGGTGGTCCCCCTCCTCTTCCTCTTCCTGCTGTCCAG
GCAGGGCG
gtgagtcccctgaccctggcatggcggctcctcttgctgggtggaggcacgtgtatgtgt
ggagagctgtgggcctgctgtgtgggttggtttcatctctctgtgcctcagtctttcctg
ctgtcaaatgggagatgggcagtcatggcttctgggatcgaacttagacatctttcctct
EXON 2  60 bp
tagatgggcagataaatacatgggcagatggatggatgggtggtggtaggagggtgcata
gatgggaaagtgggtgggtgggagggctgatgatcacttgggtgtagaccccaaggctga
gcccttctccccacacagtgcaaggccaggaatgtcattatgtcttcattgcctttgcag
CTGCCTGCAGAACCAGTGAGTGCTGTTTTCAGGACCCGCCATATCCGGATGCAGACTCAG

gttcggggcagttcctcattgttggctgaggattatgtagggctctgcctgaccccatcc
acagcggcccctcccatggcctccaccaccaggccaaagacccagccctgcctgtggtct
tgggagtccccaccccaccacctgctggcccattcttaccaggttcaagttgccctggag
EXON 3  115 bp
aggaggctgaggattcggaataggttgaggtgagagacggcaggggatgaggtaggaagg
acgcggggagggtttaggctgaggtgacgctgaaagatgtaagcatcacaaagatttgtc
ttaggcacgaagacccctccagactctggtctgttcccaagcctacaggatctcttccag
GCTCGGCCTCGGGCCCTAGGGACCTGAGATGCTATCGGATATCCAGTGATCGTTACGAGT
GCTCCTGGCAGTATGAGGGTCCCACAGCTGGGGTCAGCCACTTCCTGCGGTGTTG
gtgaggacccctctaccattcccaaaccctcacccaccatcccactcttgcttcaacccc
ctctggtgcccctactctcggatgcgtgatcttggctgggtcaacactccttcctgggct
tcagtttctcatctaagaagagagagttggaggattgtggtggggggttggtcagtgaag
EXON 4  170 bp
ggaggttgcagtgagccgagattgcgcgactgcactccagcctgggtgacagaatgaaac
tccatctccaaacaaacaaacaaacaccaaaaaaacgatgctgggatgtgatgcacaaag
tcggctgtggggtccactaggaccccagactcggcactgacaccctccttcctgctgcag
CCTTAGCTCCGGGCGCTGCTGCTACTTCGCCGCCGGCTCAGCCACCAGGCTGCAGTTCTC
CGACCAGGCTGGGGTGTCTGTGCTGTACACTGTCACACTCTGGGTGGAATCCTGGGCCAG
GAACCAGACAGAGAAGTCTCCTGAGGTGACCCTGCAGCTCTACAACTCAG
gttagcaccttgttctccccccgtccgttttttacccagagaggccatcaggctgcaagg
ctggagctagagaggattcctggcccttggcaagggacttgatactactagccattgtca
cttcacgtagtgtcacgcaaacactattgtgacaaagcagtctttcatggtccccttacc
EXON 5  140 bp
ggcttgtgtataaatcttgactttttgatcataatataccaggcttagctgggacctgca
agtgtcccctaattcatatttagggattcagttgcttaccctggacagggtggattttca
gggcccattaactcacatacgtgtgggctgcccctcgccaatccctacctctgcttccag
TTAAATATGAGCCTCCTCTGGGAGACATCAAGGTGTCCAAGTTGGCCGGGCAGCTGCGTA
TGGAGTGGGAGACCCCGGATAACCAGGTTGGTGCTGAGGTGCAGTTCCGGCACCGGACAC
CCAGCAGCCCATGGAAGTTG
gtgagtttgtttcccaagtccagggtggacacgggcctctccagggcaccttcaccccca
aatcagtctcaccatctctgcatctgtccccgctcccaaccagcccccactctagcccct
gaggtggtttttttctttttctttttttttttctgagacggagccttgctctgtcgccca
EXON 6  31 bp
cacctgagccctgggaggttgaggcttcaataagccatgattgcaccactgcactccagc
ctagatgacagagtgagaccgtgtctcagataaataagtaaataaataactaattgtaaa
acagcaaatatttttcagcaccaaaatgcaaaacaatatatgaatatgtttttattctag
GGCGACTGCGGACCTCAGGATGATGATACTG
gtgagaataataatagtaatgacaacaacagctgcagcaaattggcattaattgagcacc
tactgtatgccaggtccaatgctgaatttttttgtatgcctcttaccctgccccatagtt
cagtattggattctttccaaattgcaggtggggaaacaaatcacgacttggagggggtga
EXON 7  120 bp
ggacgtgggtgatcctggaggccctaagaggacagggcctggcctgcttctgctgagccc
ccaggacccagcacgtggctctgtacacagttggagctcaataagcacatgatggttaag
tgactggtgccaagtcctggacaattcttacggcctgatgttcgacctgcctctccccag
AGTCCTGCCTCTGCCCCCTGGAGATGAATGTGGCCCAGGAATTCCAGCTCCGACGACGGC
AGCTGGGGAGCCAAGGAAGTTCCTGGAGCAAGTGGAGCAGCCCCGTGTGCGTTCCCCCTG

gtaagatcactctgagtacaggaacaggggcaagcattagaaataaggcaacagccggag
gtggtggtgcacacctgtagttccagctgctcagaaggctgaggcgggaggatcacttga
ggccagtggtttgagaccagcccgggcaacatagtgagaccccatctctaaaaaataaaa
EXON 8  83 bp
ttatccctggggatgcaaattgtgttaatttttcttccttcagttttttctcttttctgc
aatttggggcagcaagggattttcactttgtaaatgtggagaatccatcatttacaaaga
aaacatccatcagtctttctctccttccaattcgtctagttggtttggttctgattgcag
AAAACCCCCCACAGCCTCAGGTGAGATTCTCGGTGGAGCAGCTGGGCCAGGATGGGAGGA
GGCGGCTGACCCTGAAAGAGCAG
gtaacggggctgtcacagggctgtggggtggcctgggatggggagcaggaggcaaaagcc
taggcgggggatgagcaagtggtagatggagggagatgagatgtagaggtggcaggaagt
gggcaaattgtgggtttaactctgaaggtaatagggagccatggagtgtgtgtgtgagca
EXON 9  238 bp
gaatgcctgtctcacagcagctttgccagcattgaggtttattattcttttaatttttga
tgcatgttattggctgtggcctttgtccaagtctgtcttcataggctgtgccctgctgtc
tgcctatgggatgatgagtgtgatcaggtacccacaagctgtctttcatactcctgacag
CCAACCCAGCTGGAGCTTCCAGAAGGCTGTCAAGGGCTGGCGCCTGGCACGGAGGTCACT
TACCGACTACAGCTCCACATGCTGTCCTGCCCGTGTAAGGCCAAGGCCACCAGGACCCTG
CACCTGGGGAAGATGCCCTATCTCTCGGGTGCTGCCTACAACGTGGCTGTCATCTCCTCG
AACCAATTTGGTCCTGGCCTGAACCAGACGTGGCACATTCCTGCCGACACCCACACAG
gtgcctcctctgggtggggagggcggtatgagggcccctcagagctgagcacctactctg
agcctcagctagaccagggtgagaggagcgaggcagaaaattttaaaggagtgcctgatt
taggggtgtatcaaaaattcagtaatcagccaggcacggtggctcacacctgtaatccca