Gene IL12RB1 Variant 1
DNA : 27.33 KbNT_011295
mRNA : 2100 bp NM_005535
CDS : 1989 bp NP_005526
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  128 bp
agacttgctccagagtctgtggccgccaccatcaccaccaccacggagctgacttcctgg
gtttctctttcactttgacttgccttagggatgggctgtgacactttactttttttcttt
tttcttttttttcagtcttttctccttgctcagcttcaatgtgttccggagtggggacgg
GGTGGCTGAACCTCGCAGGTGGCAGAGAGGCTCCCCTGGGGCTGTGGGGCTCTACGTGGA
TCCGATGGAGCCGCTGGTGACCTGGGTGGTCCCCCTCCTCTTCCTCTTCCTGCTGTCCAG
GCAGGGCG
gtgagtcccctgaccctggcatggcggctcctcttgctgggtggaggcacgtgtatgtgt
ggagagctgtgggcctgctgtgtgggttggtttcatctctctgtgcctcagtctttcctg
ctgtcaaatgggagatgggcagtcatggcttctgggatcgaacttagacatctttcctct
EXON 2  60 bp
tagatgggcagataaatacatgggcagatggatggatgggtggtggtaggagggtgcata
gatgggaaagtgggtgggtgggagggctgatgatcacttgggtgtagaccccaaggctga
gcccttctccccacacagtgcaaggccaggaatgtcattatgtcttcattgcctttgcag
CTGCCTGCAGAACCAGTGAGTGCTGTTTTCAGGACCCGCCATATCCGGATGCAGACTCAG

gttcggggcagttcctcattgttggctgaggattatgtagggctctgcctgaccccatcc
acagcggcccctcccatggcctccaccaccaggccaaagacccagccctgcctgtggtct
tgggagtccccaccccaccacctgctggcccattcttaccaggttcaagttgccctggag
EXON 3  115 bp
aggaggctgaggattcggaataggttgaggtgagagacggcaggggatgaggtaggaagg
acgcggggagggtttaggctgaggtgacgctgaaagatgtaagcatcacaaagatttgtc
ttaggcacgaagacccctccagactctggtctgttcccaagcctacaggatctcttccag
GCTCGGCCTCGGGCCCTAGGGACCTGAGATGCTATCGGATATCCAGTGATCGTTACGAGT
GCTCCTGGCAGTATGAGGGTCCCACAGCTGGGGTCAGCCACTTCCTGCGGTGTTG
gtgaggacccctctaccattcccaaaccctcacccaccatcccactcttgcttcaacccc
ctctggtgcccctactctcggatgcgtgatcttggctgggtcaacactccttcctgggct
tcagtttctcatctaagaagagagagttggaggattgtggtggggggttggtcagtgaag
EXON 4  170 bp
ggaggttgcagtgagccgagattgcgcgactgcactccagcctgggtgacagaatgaaac
tccatctccaaacaaacaaacaaacaccaaaaaaacgatgctgggatgtgatgcacaaag
tcggctgtggggtccactaggaccccagactcggcactgacaccctccttcctgctgcag
CCTTAGCTCCGGGCGCTGCTGCTACTTCGCCGCCGGCTCAGCCACCAGGCTGCAGTTCTC
CGACCAGGCTGGGGTGTCTGTGCTGTACACTGTCACACTCTGGGTGGAATCCTGGGCCAG
GAACCAGACAGAGAAGTCTCCTGAGGTGACCCTGCAGCTCTACAACTCAG
gttagcaccttgttctccccccgtccgttttttacccagagaggccatcaggctgcaagg
ctggagctagagaggattcctggcccttggcaagggacttgatactactagccattgtca
cttcacgtagtgtcacgcaaacactattgtgacaaagcagtctttcatggtccccttacc
EXON 5  140 bp
ggcttgtgtataaatcttgactttttgatcataatataccaggcttagctgggacctgca
agtgtcccctaattcatatttagggattcagttgcttaccctggacagggtggattttca
gggcccattaactcacatacgtgtgggctgcccctcgccaatccctacctctgcttccag
TTAAATATGAGCCTCCTCTGGGAGACATCAAGGTGTCCAAGTTGGCCGGGCAGCTGCGTA
TGGAGTGGGAGACCCCGGATAACCAGGTTGGTGCTGAGGTGCAGTTCCGGCACCGGACAC
CCAGCAGCCCATGGAAGTTG
gtgagtttgtttcccaagtccagggtggacacgggcctctccagggcaccttcaccccca
aatcagtctcaccatctctgcatctgtccccgctcccaaccagcccccactctagcccct
gaggtggtttttttctttttctttttttttttctgagacggagccttgctctgtcgccca
EXON 6  31 bp
cacctgagccctgggaggttgaggcttcaataagccatgattgcaccactgcactccagc
ctagatgacagagtgagaccgtgtctcagataaataagtaaataaataactaattgtaaa
acagcaaatatttttcagcaccaaaatgcaaaacaatatatgaatatgtttttattctag
GGCGACTGCGGACCTCAGGATGATGATACTG
gtgagaataataatagtaatgacaacaacagctgcagcaaattggcattaattgagcacc
tactgtatgccaggtccaatgctgaatttttttgtatgcctcttaccctgccccatagtt
cagtattggattctttccaaattgcaggtggggaaacaaatcacgacttggagggggtga
EXON 7  120 bp
ggacgtgggtgatcctggaggccctaagaggacagggcctggcctgcttctgctgagccc
ccaggacccagcacgtggctctgtacacagttggagctcaataagcacatgatggttaag
tgactggtgccaagtcctggacaattcttacggcctgatgttcgacctgcctctccccag
AGTCCTGCCTCTGCCCCCTGGAGATGAATGTGGCCCAGGAATTCCAGCTCCGACGACGGC
AGCTGGGGAGCCAAGGAAGTTCCTGGAGCAAGTGGAGCAGCCCCGTGTGCGTTCCCCCTG

gtaagatcactctgagtacaggaacaggggcaagcattagaaataaggcaacagccggag
gtggtggtgcacacctgtagttccagctgctcagaaggctgaggcgggaggatcacttga
ggccagtggtttgagaccagcccgggcaacatagtgagaccccatctctaaaaaataaaa
EXON 8  83 bp
ttatccctggggatgcaaattgtgttaatttttcttccttcagttttttctcttttctgc
aatttggggcagcaagggattttcactttgtaaatgtggagaatccatcatttacaaaga
aaacatccatcagtctttctctccttccaattcgtctagttggtttggttctgattgcag
AAAACCCCCCACAGCCTCAGGTGAGATTCTCGGTGGAGCAGCTGGGCCAGGATGGGAGGA
GGCGGCTGACCCTGAAAGAGCAG
gtaacggggctgtcacagggctgtggggtggcctgggatggggagcaggaggcaaaagcc
taggcgggggatgagcaagtggtagatggagggagatgagatgtagaggtggcaggaagt
gggcaaattgtgggtttaactctgaaggtaatagggagccatggagtgtgtgtgtgagca
EXON 9  238 bp
gaatgcctgtctcacagcagctttgccagcattgaggtttattattcttttaatttttga
tgcatgttattggctgtggcctttgtccaagtctgtcttcataggctgtgccctgctgtc
tgcctatgggatgatgagtgtgatcaggtacccacaagctgtctttcatactcctgacag
CCAACCCAGCTGGAGCTTCCAGAAGGCTGTCAAGGGCTGGCGCCTGGCACGGAGGTCACT
TACCGACTACAGCTCCACATGCTGTCCTGCCCGTGTAAGGCCAAGGCCACCAGGACCCTG
CACCTGGGGAAGATGCCCTATCTCTCGGGTGCTGCCTACAACGTGGCTGTCATCTCCTCG
AACCAATTTGGTCCTGGCCTGAACCAGACGTGGCACATTCCTGCCGACACCCACACAG
gtgcctcctctgggtggggagggcggtatgagggcccctcagagctgagcacctactctg
agcctcagctagaccagggtgagaggagcgaggcagaaaattttaaaggagtgcctgatt
taggggtgtatcaaaaattcagtaatcagccaggcacggtggctcacacctgtaatccca
EXON 10  168 bp
actttgtgcctggccccaaggcagcctccagtgcagggaaacagccaaacacagacaccc
ctggccctgtagggtcaggggtatagacgagagggtgggagagaggctgcaggagccaga
gaaggggactggggagagagatggcaactgtctcgatgcgtctctcccctctccttccag
AACCAGTGGCTCTGAATATCAGCGTCGGAACCAACGGGACCACCATGTATTGGCCAGCCC
GGGCTCAGAGCATGACGTATTGCATTGAATGGCAGCCTGTGGGCCAGGACGGGGGCCTTG
CCACCTGCAGCCTGACTGCGCCGCAAGACCCGGATCCGGCTGGAATGG
gtaatggcctggaatggcctgcgcctacccctcctctgtgccctcccttttaggtcctgg
tgggttcaaacctgcagggaaggcacacagcgggtgtctaaggcccagagaggtgttgct
gcttactcaatgtcatacagaggtagggacagggtgaggttcggagcctctcacccatat
EXON 11  138 bp
gggatggggttgggggtgttgcatagggaagagatcttggaggaggggatattggtgcaa
gggctttgaaacatgagtaggagttttctgggggttcctggcagatggcacagccagtgc
aaaggtgcagaggtgggaacacaatctactgaatggcctggcctttgcttatccttccag
CAACCTACAGCTGGAGTCGAGAGTCTGGGGCAATGGGGCAGGAAAAGTGTTACTACATTA
CCATCTTTGCCTCTGCGCACCCCGAGAAGCTCACCTTGTGGTCTACGGTCCTGTCCACCT
ACCACTTTGGGGGCAATG
gtaagtgacccaaacctgcaggtttacattattttttctttttaaataatttaaaaaaat
agaggctgggcacagtgactcacgcatgtaatcccagcactttgggaggccaaggtgggt
ggatcacctgaggtcaggagtttgaaaccagcctggccaatgtggcgaaaccctgtctct
EXON 12  156 bp
tttttgtatttttagtagagaaggggttttgccatgttggccaggctggtcttgaactcc
tggcctcaaatgacttacccacctcggcctcccaaagtgctgggattacaggtgcgagcc
actgtgccaggcctcgaccagcattcttggtgttgactatgacaatggtactggttgcag
CCTCAGCAGCTGGGACACCGCACCACGTCTCGGTGAAGAATCATAGCTTGGACTCTGTGT
CTGTGGACTGGGCACCATCCCTGCTGAGCACCTGTCCCGGCGTCCTAAAGGAGTATGTTG
TCCGCTGCCGAGATGAAGACAGCAAACAGGTGTCAG
gtacgtgaggcagtgcagacctggcttggggaggaagggaggatcctggcctgtgatctc
tcttgctgtgtgaccctgggcaccttgccgtccttctctgggccttggttatcaaaccct
taaaacaagagaattggctgggcgcagtggctcacgcctgtaatcccagcactttgggag
EXON 13  135 bp
tccagcctgggcgacagagcaagactccgtctcaaaaaaaaaaaaaaaaaaagaaagaaa
gagtagagattttagcaaaatgcctatgaatccccaccccacccacaggctgtggtagcc
cagcctggcctctgaggagtaaagaggtcccaggactcagggttgcctctcccactgcag
AGCATCCCGTGCAGCCCACAGAGACCCAAGTTACCCTCAGTGGCCTGCGGGCTGGTGTAG
CCTACACGGTGCAGGTGCGAGCAGACACAGCGTGGCTGAGGGGTGTCTGGAGCCAGCCCC
AGCGCTTCAGCATCG
gtgagtggagggggtaggacccagttatttacccagcatgcactgcactgcgcttcccac
aatgatcttagcagccctgccctcactctcactccctctatggctccctactgccctcag
gagaaagtagcagctcaaactgctcccattgccttctctcgcagcttcctctcacactcc
EXON 14  97 bp
ccaggcctttatttcttgacagctaccgggcaggtgggttctgtggtctcccagtgagaa
gcccgtggcatgtgcaccaggatcagcagcaagttcatggagaaaccaggccctcctagc
tccttccctgaggaagaggcaggaggtagccctctgccaacccacgctctcccacctcag
AAGTGCAGGTTTCTGATTGGCTCATCTTCTTCGCCTCCCTGGGGAGCTTCCTGAGCATCC
TTCTCGTGGGCGTCCTTGGCTACCTTGGCCTGAACAG
gtaactgacacctcttaccgttaccatagcgatggtaatgatgctgggcaggggagccct
aaagtggagcttagcccgcagattgggtccttggctttgcccaggaaataattcaagggc
aagccagaggtagaagaaaacagctttattgaagcagcagttatagctccgtgactgcct
EXON 15  76 bp
acgtttgtaatctcagctactcaggaggctgagtcaggagaatcgattgaacccaggagg
cagaggttgcagtgagccgagatcgcgccactgcactccagcctgggcaacagagcaaga
ctccgtctccaaaaaaaaaaaaaacctcagctcctctcactggtcccctttcctccccag
GGCCGCACGGCACCTGTGCCCGCCGCTGCCCACACCCTGTGCCAGCTCCGCCATTGAGTT
CCCTGGAGGGAAGGAG
gtaaggatgccttttctaattccaagtctttttattgggtgcacatgctggacaagggtt
acgcattagctcattttattctctcccaattcatcaaggtaaggactccaaaaccagtgc
tccataccccttcccattttaaagacaggcaggcagaggtccatttcctggcactagaaa
EXON 16  192 bp
ctcaagtgatccacccgcctcagcctcccaaagtgctgggatgacaggtgtgagccactg
cacccgtccaggtctcaggatgttagagaatttaaccagcagtgacctggtccgttccat
cctgctgtggatgggaagtagagctctgctcacagctgtggccctaccctccctctgcag
ACTTGGCAGTGGATCAACCCAGTGGACTTCCAGGAAGAGGCATCCCTGCAGGAGGCCCTG
GTGGTAGAGATGTCCTGGGACAAAGGCGAGAGGACTGAGCCTCTCGAGAAGACAGAGCTA
CCTGAGGGTGCCCCTGAGCTGGCCCTGGATACAGAGTTGTCCTTGGAGGATGGAGACAGG
TGCAAGGCCAAG
gtcctggggcccagtgggccagacggtcaggggtgcaaccctgcccggggggtggggggg
ctagacatccatcgctcctgggatatcagggcctggaggcctgagggagaaacgaaaaca
tccactttgtcttacagacacgaagagcgactatctcaatcacaacggctggttattaag
EXON 17  53 bp
ctgagggagaaacgaaaacatccactttgtcttacagacacgaagagcgactatctcaat
cacaacggctggttattaagcacttatggcatacccagcccattccatccactcacatga
ttccctaccaaatccctacaaccaccccctgaaaggaaccatgactgttgtactttacag
ATGTGATCGTTGAGGCTCAGAGAGGGTGAGTGACTCGCCCGAGGCTACGTAGC
acacacaggagtcacatttggacccaaataacccagagctcctccaggctccagtgcacc
tgcctcctctctgccccgtgcctgttgccacccatcctgcgggggaaccctagatgctgc
catgaaatggaagctgctgcaccctgctgggcctggcatccgtggggcaggagcagaccc