Gene ICAM4 Variant 2
DNA : 1.52 KbNT_011295
mRNA : 1243 bp NM_001544
CDS : 816 bp NP_001535
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  403 bp
ctaatgaggcctggaatcttattcttgacctggggagcggaatccctttttgcagtactc
ccgggccctctgttggggcctccccttcctctccagggtggagtcgaggaggcggggctg
cgggcctccttatctctagagccggccctggctctctggcgcggggccccttagtccggg
CTTTTTGCCATGGGGTCTCTGTTCCCTCTGTCGCTGCTGTTTTTTTTGGCGGCCGCCTAC
CCGGGAGTTGGGAGCGCGCTGGGACGCCGGACTAAGCGGGCGCAAAGCCCCAAGGGTAGC
CCTCTCGCGCCCTCCGGGACCTCAGTGCCCTTCTGGGTGCGCATGAGCCCGGAGTTCGTG
GCTGTGCAGCCGGGGAAGTCAGTGCAGCTCAATTGCAGCAACAGCTGTCCCCAGCCGCAG
AATTCCAGCCTCCGCACCCCGCTGCGGCAAGGCAAGACGCTCAGAGGGCCGGGTTGGGTG
TCTTACCAGCTGCTCGACGTGAGGGCCTGGAGCTCCCTCGCGCACTGCCTCGTGACCTGC
GCAGGAAAAACACGCTGGGCCACCTCCAGGATCACCGCCTACA
gtgagggacaggggctcggtcccggctggggtgaggggagggggctggaagaggtggggg
aagggtagttgacagtcgctctatagggagcgcccgcggacctcactcagaggctccccc
ttgccttagaaccgccccacagcgtgattttggagcctccggtcttaaagggcaggaaat
EXON 2  303 bp
tgacctgcgcaggaaaaacacgctgggccacctccaggatcaccgcctacagtgagggac
aggggctcggtcccggctggggtgaggggagggggctggaagaggtgggggaagggtagt
tgacagtcgctctatagggagcgcccgcggacctcactcagaggctcccccttgccttag
AACCGCCCCACAGCGTGATTTTGGAGCCTCCGGTCTTAAAGGGCAGGAAATACACTTTGC
GCTGCCACGTGACGCAGGTGTTCCCGGTGGGCTACTTGGTGGTGACCCTGAGGCATGGAA
GCCGGGTCATCTATTCCGAAAGCCTGGAGCGCTTCACCGGCCTGGATCTGGCCAACGTGA
CCTTGACCTACGAGTTTGCTGCTGGACCCCGCGACTTCTGGCAGCCCGTGATCTGCCACG
CGCGCCTCAATCTCGACGGCCTGGTGGTCCGCAACAGCTCGGCACCCATTACACTGATGC
TCG
gtgaggcacccctgtaaccctggggactaggaggaagggggcagagagagttatgacccc
gagagggcgcacagaccaagcgtgagctccacgcgggtcgacagacctccctgtgttccg
ttcctaattctcgccttctgctcccagcttggagccccgcgcccacagctttggcctccg
EXON 3  537 bp
gcaacagctcggcacccattacactgatgctcggtgaggcacccctgtaaccctggggac
taggaggaagggggcagagagagttatgaccccgagagggcgcacagaccaagcgtgagc
tccacgcgggtcgacagacctccctgtgttccgttcctaattctcgccttctgctcccag
CTTGGAGCCCCGCGCCCACAGCTTTGGCCTCCGGTTCCATCGCTGCCCTTGTAGGGATCC
TCCTCACTGTGGGCGCTGCGTACCTATGCAAGTGCCTAGCTATGAAGTCCCAGGCGTAAA
GGGGGATGTTCTATGCCGGCTGAGCGAGAAAAAGAGGAATATGAAACAATCTGGGGAAAT
GGCCATACATGGTGGCTGACGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGAGAA
TCGCTTGAGCCCAGGAGTTCGAGACCAGCCTGGACAACATAGTGAGACCCCGTCTATGCA
AAAAATACACAAATTAGCCTGGTGTGGTGGCCCGCACCTGTGGTCCCAGCTACCCGGGAG
GCTGAGTTGGGAGGATCCTTTGAGCCCTGAAAGTCGAGGTTGCAGTGAGCCTTGATCGTG
CCACTGCACTCCAGCCTGGGGGACAGAGCACGACCCTGTCTCCAAAAATAAAATAAAAAT
AAAAATAAATATTGGCGGGGGAACCCTCTGGAATCAATAAAGGCTTCCTTAACCAGC
ctctgtcctgtgacctaagggtccgcattactgcccttcttcggaggaactggtttgttt
ttgttgttgttgttgtttttgcgatcactttctccaagttccttgtctccctgagggcac
ctgaggtttcctcactcagggcccacctggggtcccgaagccccagactctgtgtatccc