Gene ICAM4 Variant 1
DNA : 1.52 KbNT_011295
mRNA : 1390 bp NM_022377
CDS : 714 bp NP_071772
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  403 bp
ctaatgaggcctggaatcttattcttgacctggggagcggaatccctttttgcagtactc
ccgggccctctgttggggcctccccttcctctccagggtggagtcgaggaggcggggctg
cgggcctccttatctctagagccggccctggctctctggcgcggggccccttagtccggg
CTTTTTGCCATGGGGTCTCTGTTCCCTCTGTCGCTGCTGTTTTTTTTGGCGGCCGCCTAC
CCGGGAGTTGGGAGCGCGCTGGGACGCCGGACTAAGCGGGCGCAAAGCCCCAAGGGTAGC
CCTCTCGCGCCCTCCGGGACCTCAGTGCCCTTCTGGGTGCGCATGAGCCCGGAGTTCGTG
GCTGTGCAGCCGGGGAAGTCAGTGCAGCTCAATTGCAGCAACAGCTGTCCCCAGCCGCAG
AATTCCAGCCTCCGCACCCCGCTGCGGCAAGGCAAGACGCTCAGAGGGCCGGGTTGGGTG
TCTTACCAGCTGCTCGACGTGAGGGCCTGGAGCTCCCTCGCGCACTGCCTCGTGACCTGC
GCAGGAAAAACACGCTGGGCCACCTCCAGGATCACCGCCTACA
gtgagggacaggggctcggtcccggctggggtgaggggagggggctggaagaggtggggg
aagggtagttgacagtcgctctatagggagcgcccgcggacctcactcagaggctccccc
ttgccttagaaccgccccacagcgtgattttggagcctccggtcttaaagggcaggaaat
EXON 2  987 bp
tgacctgcgcaggaaaaacacgctgggccacctccaggatcaccgcctacagtgagggac
aggggctcggtcccggctggggtgaggggagggggctggaagaggtgggggaagggtagt
tgacagtcgctctatagggagcgcccgcggacctcactcagaggctcccccttgccttag
AACCGCCCCACAGCGTGATTTTGGAGCCTCCGGTCTTAAAGGGCAGGAAATACACTTTGC
GCTGCCACGTGACGCAGGTGTTCCCGGTGGGCTACTTGGTGGTGACCCTGAGGCATGGAA
GCCGGGTCATCTATTCCGAAAGCCTGGAGCGCTTCACCGGCCTGGATCTGGCCAACGTGA
CCTTGACCTACGAGTTTGCTGCTGGACCCCGCGACTTCTGGCAGCCCGTGATCTGCCACG
CGCGCCTCAATCTCGACGGCCTGGTGGTCCGCAACAGCTCGGCACCCATTACACTGATGC
TCGGTGAGGCACCCCTGTAACCCTGGGGACTAGGAGGAAGGGGGCAGAGAGAGTTATGAC
CCCGAGAGGGCGCACAGACCAAGCGTGAGCTCCACGCGGGTCGACAGACCTCCCTGTGTT
CCGTTCCTAATTCTCGCCTTCTGCTCCCAGCTTGGAGCCCCGCGCCCACAGCTTTGGCCT
CCGGTTCCATCGCTGCCCTTGTAGGGATCCTCCTCACTGTGGGCGCTGCGTACCTATGCA
AGTGCCTAGCTATGAAGTCCCAGGCGTAAAGGGGGATGTTCTATGCCGGCTGAGCGAGAA
AAAGAGGAATATGAAACAATCTGGGGAAATGGCCATACATGGTGGCTGACGCCTGTAATC
CCAGCACTTTGGGAGGCCGAGGCAGGAGAATCGCTTGAGCCCAGGAGTTCGAGACCAGCC
TGGACAACATAGTGAGACCCCGTCTATGCAAAAAATACACAAATTAGCCTGGTGTGGTGG
CCCGCACCTGTGGTCCCAGCTACCCGGGAGGCTGAGTTGGGAGGATCCTTTGAGCCCTGA
AAGTCGAGGTTGCAGTGAGCCTTGATCGTGCCACTGCACTCCAGCCTGGGGGACAGAGCA
CGACCCTGTCTCCAAAAATAAAATAAAAATAAAAATAAATATTGGCGGGGGAACCCTCTG
GAATCAATAAAGGCTTCCTTAACCAGC
ctctgtcctgtgacctaagggtccgcattactgcccttcttcggaggaactggtttgttt
ttgttgttgttgttgtttttgcgatcactttctccaagttccttgtctccctgagggcac
ctgaggtttcctcactcagggcccacctggggtcccgaagccccagactctgtgtatccc